Crybb2 (NM_007773) Mouse Untagged Clone
CAT#: MC208339
Crybb2 (untagged) - Mouse crystallin, beta B2 (Crybb2), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Aey; Cryb-; Cryb-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208339 representing NM_007773
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCTCAGACCACCAGACACAGGCGGGCAAGCCCCAGCCCCTTAACCCCAAGATCATCATCTTCGAAC AGGAGAACTTCCAGGGCCATTCCCACGAGCTCAGCGGGCCCTGCCCCAACCTGAAGGAGACTGGTATGGA GAAGGCGGGCTCCGTCCTGGTGCAGGCTGGACCCTGGGTGGGCTACGAGCAGGCTAATTGCAAGGGCGAG CAGTTTGTGTTTGAAAAGGGCGAGTACCCACGTTGGGACTCCTGGACCAGCAGCCGGAGGACAGACTCCC TCAGCTCTCTGAGGCCCATCAAAGTGGACAGCCAAGAGCACAAGATCATCTTATATGAGAACCCCAACTT TACTGGCAAGAAGATGGAGATTGTAGACGACGATGTGCCCAGCTTCCATGCCCATGGATACCAGGAAAAG GTGTCTTCCGTGCGTGTGCAGAGCGGCACGTGGGTGGGGTACCAGTACCCTGGCTACCGTGGGCTGCAGT ACCTGCTGGAGAAGGGGGATTACAAGGACAACAGCGACTTCGGGGCCCCTCACCCCCAGGTGCAGTCTGT GCGTCGCATCCGTGACATGCAGTGGCACCAGCGAGGTGCCTTCCACCCCTCCAGCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007773 |
Insert Size | 618 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007773.4, NP_031799.1 |
RefSeq Size | 916 bp |
RefSeq ORF | 618 bp |
Locus ID | 12961 |
UniProt ID | P62696 |
Gene Summary | This gene is a member of the beta-crystallin family. Beta crystallins, along with alpha and gamma crystallins, are the major proteins found in the eye lens. These proteins maintain the refractive index of the lens whilst also maintaining its transparency. Since lens central fiber cells lose their nuclei during development, crystallins are made and then retained throughout life, making them extremely stable proteins. Beta and gamma crystallins are considered be a superfamily and have a similar domain architecture, including four Greek Key motifs. Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. The protein encoded by this gene may have Ca2+-binding activity and could be associated with potential functions in the hippocampus and in sperm. Targeted knockout of this gene in mouse induces age-related cataract. A chain-terminating mutation in a similar gene in human was found to cause type 2 cerulean cataracts. [provided by RefSeq, Feb 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223426 | Crybb2 (tGFP-tagged) - Mouse crystallin beta B2 (Crybb2), (10ug) |
CNY 2850.00 |
|
MR223426 | Crybb2 (Myc-DDK-tagged) - Mouse crystallin, beta B2 (Crybb2) |
CNY 2400.00 |
|
MR223426L3 | Lenti ORF clone of Crybb2 (Myc-DDK-tagged) - Mouse crystallin, beta B2 (Crybb2) |
CNY 4750.00 |
|
MR223426L4 | Lenti ORF clone of Crybb2 (mGFP-tagged) - Mouse crystallin, beta B2 (Crybb2) |
CNY 4750.00 |