Csnk2b (NM_009975) Mouse Untagged Clone
CAT#: MC208346
Csnk2b (untagged) - Mouse casein kinase 2, beta polypeptide (Csnk2b), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | CK II beta |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208346 representing NM_009975
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGTAGCTCTGAGGAGGTGTCCTGGATTTCCTGGTTCTGTGGGCTCCGTGGTAATGAATTCTTCTGTG AGGTGGATGAAGACTACATCCAGGACAAATTTAATCTTACTGGACTCAATGAGCAGGTGCCTCACTATCG ACAAGCTCTGGACATGATCTTAGACCTGGAACCTGATGAAGAGCTGGAAGACAACCCCAACCAGAGCGAC TTGATCGAACAGGCAGCTGAGATGCTTTATGGGTTGATCCACGCCCGCTACATCCTCACCAACCGAGGCA TCGCACAAATGTTGGAAAAGTACCAGCAGGGAGACTTTGGCTACTGTCCTCGTGTATACTGTGAGAACCA GCCAATGCTTCCTATCGGCCTTTCAGACATCCCAGGCGAGGCCATGGTGAAACTCTACTGCCCCAAGTGC ATGGACGTGTACACACCCAAGTCCTCCAGACACCACCACACGGACGGCGCATACTTCGGCACTGGTTTCC CTCACATGCTCTTCATGGTGCATCCAGAGTACCGGCCCAAGCGACCTGCCAACCAGTTTGTACCCAGGCT CTATGGTTTCAAGATCCATCCAATGGCTTACCAGCTGCAGCTCCAAGCCGCCAGCAACTTCAAGAGCCCA GTCAAGACTATTCGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_009975 |
| Insert Size | 648 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_009975.3, NP_034105.1 |
| RefSeq Size | 970 bp |
| RefSeq ORF | 648 bp |
| Locus ID | 13001 |
| UniProt ID | P67871 |
| Gene Summary | This gene encodes the beta subunit of the casein kinase 2 enzyme, which is a heterotetramer comprised of alpha and/or alpha-prime catalytic subunits and two regulatory beta subunits. Casein kinase 2 is involved in the regulation of several cellular processes including gene expression, protein synthesis and cell proliferation. Knockout of this gene in mice leads to embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015] Transcript Variant: This variant (2) contains an alternate 5' terminal exon and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform (2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202367 | Csnk2b (tGFP-tagged) - Mouse casein kinase 2, beta polypeptide (Csnk2b) |
CNY 2850.00 |
|
| MR202367 | Csnk2b (Myc-DDK-tagged) - Mouse casein kinase 2, beta polypeptide (Csnk2b) |
CNY 2400.00 |
|
| MR202367L3 | Lenti ORF clone of Csnk2b (Myc-DDK-tagged) - Mouse casein kinase 2, beta polypeptide (Csnk2b) |
CNY 4750.00 |
|
| MR202367L4 | Lenti ORF clone of Csnk2b (mGFP-tagged) - Mouse casein kinase 2, beta polypeptide (Csnk2b) |
CNY 4750.00 |
