Fcer1a (NM_010184) Mouse Untagged Clone
CAT#: MC208469
Fcer1a (untagged) - Mouse Fc receptor, IgE, high affinity I, alpha polypeptide (Fcer1a), (10ug)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Fce1a; fcepsilonri; FcERI; Fcr-5 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_010184, the custom clone sequence may differ by one or more nucleotides
ATGGTCACTGGAAGGTCTGCCCAGCTGTGCCTAGCACTGCTGTTCATGTCTCTTGATGTCATTCTGACAG CCACTGAGAAATCTGTACTGACCTTGGACCCACCATGGATTAGAATATTTACAGGAGAGAAAGTGACCCT TTCCTGCTATGGGAACAATCACCTTCAAATGAACTCTACTACTAAATGGATCCACAATGGTACCGTCTCT GAGGTGAACTCTTCACATTTGGTCATTGTGAGTGCCACCGTTCAAGACAGTGGAAAATACATATGTCAGA AGCAAGGATTGTTTAAGAGTAAACCTGTGTACTTGAATGTAACGCAAGATTGGCTGCTCCTTCAGACATC TGCTGACATGGTCTTAGTCCATGGATCCTTTGACATCAGATGCCATGGCTGGAAGAACTGGAATGTCCGC AAGGTGATCTACTACAGGAATGACCATGCTTTCAACTACAGTTATGAGAGCCCCGTCTCCATTAGAGAGG CCACACTGAATGACAGTGGCACCTACCACTGCAAGGGCTATCTTAGGCAGGTGAAATATGAATCTGACAA ATTCAGAATTGCTGTAGTAAAAGCTTACAAATGCAAGTATTATTGGCTACAACTAATTTTCCCATTGTTG GTGGCGATTCTGTTTGCTGTGGACACGGGGTTATTGCTCTCAACCGAAGAACAGTTCAAATCAGTCTTGG AGATTCAGAAGACTGGAAAATACAAGAAAGTTGAAACCGAACTCCTAACCTAG |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_010184 |
| Insert Size | 753 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC125455, AAI25456 |
| RefSeq Size | 869 bp |
| RefSeq ORF | 753 bp |
| Locus ID | 14125 |
| UniProt ID | P20489 |
| Gene Summary | Binds to the Fc region of immunoglobulins epsilon. High affinity receptor. Responsible for initiating the allergic response. Binding of allergen to receptor-bound IgE leads to cell activation and the release of mediators (such as histamine) responsible for the manifestations of allergy. The same receptor also induces the secretion of important lymphokines.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG226932 | Fcer1a (tGFP-tagged) - Mouse Fc receptor IgE high affinity I alpha polypeptide (Fcer1a), (10ug) |
CNY 4000.00 |
|
| MR226932 | Fcer1a (Myc-DDK-tagged) - Mouse Fc receptor, IgE, high affinity I, alpha polypeptide (Fcer1a) |
CNY 2400.00 |
|
| MR226932L3 | Lenti ORF clone of Fcer1a (Myc-DDK-tagged) - Mouse Fc receptor, IgE, high affinity I, alpha polypeptide (Fcer1a) |
CNY 4750.00 |
|
| MR226932L4 | Lenti ORF clone of Fcer1a (mGFP-tagged) - Mouse Fc receptor, IgE, high affinity I, alpha polypeptide (Fcer1a) |
CNY 4750.00 |
