Folr1 (NM_008034) Mouse Untagged Clone
CAT#: MC208500
Folr1 (untagged) - Mouse folate receptor 1 (adult) (Folr1), (10ug)
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | FBP1; Folbp-1; Folbp1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208500 representing NM_008034
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTCACCTGATGACTGTGCAGTTGTTGCTCCTGGTGATGTGGATGGCCGAATGTGCTCAGTCCAGAG CTACTCGGGCCAGGACTGAACTTCTCAATGTCTGCATGGATGCCAAACACCACAAAGAAAAACCGGGCCC TGAGGACAATTTACACGACCAGTGCAGCCCCTGGAAGACGAATTCCTGCTGTTCCACGAACACAAGCCAG GAAGCACATAAGGACATTTCCTACCTGTACCGGTTCAACTGGAACCACTGCGGAACTATGACATCGGAAT GCAAACGGCACTTTATCCAAGACACCTGCCTCTATGAGTGTTCCCCGAACTTGGGACCCTGGATCCAGCA GGTGGACCAGAGCTGGCGCAAAGAGCGGATCCTTGATGTTCCCCTGTGCAAAGAGGACTGTCAGCAGTGG TGGGAGGACTGCCAGAGCTCTTTTACCTGCAAGAGCAATTGGCACAAGGGATGGAACTGGTCCTCGGGGC ATAACGAGTGTCCTGTGGGAGCCTCCTGCCATCCCTTCACCTTCTACTTCCCCACATCTGCTGCTCTGTG TGAGGAAATCTGGAGTCACTCCTACAAGCTCAGCAACTACAGTCGAGGGAGCGGCCGCTGCATTCAGATG TGGTTCGACCCAGCCCAGGGCAACCCCAACGAGGAAGTGGCGAGGTTCTATGCCGAGGCCATGAGTGGAG CTGGGTTTCATGGGACCTGGCCACTCTTGTGCAGCCTGTCCTTAGTGCTGCTCTGGGTGATCAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008034 |
Insert Size | 768 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC138795, AAI38796 |
RefSeq Size | 1052 bp |
RefSeq ORF | 768 bp |
Locus ID | 14275 |
UniProt ID | P35846 |
Gene Summary | Binds to folate and reduced folic acid derivatives and mediates delivery of 5-methyltetrahydrofolate and folate analogs into the interior of cells. Has high affinity for folate and folic acid analogs at neutral pH. Exposure to slightly acidic pH after receptor endocytosis triggers a conformation change that strongly reduces its affinity for folates and mediates their release. Required for normal embryonic development and normal cell proliferation. Required for renal folate reabsorption.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses a different splice site in the 5' UTR, compared to variant 1. Variants 1, 2, 3, and 4 all encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222958 | Folr1 (tGFP-tagged) - Mouse folate receptor 1 (adult) (Folr1), (10ug) |
CNY 5200.00 |
|
MR222958 | Folr1 (Myc-DDK-tagged) - Mouse folate receptor 1 (adult) (Folr1) |
CNY 3600.00 |
|
MR222958L3 | Lenti ORF clone of Folr1 (Myc-DDK-tagged) - Mouse folate receptor 1 (adult) (Folr1) |
CNY 4470.00 |
|
MR222958L4 | Lenti ORF clone of Folr1 (mGFP-tagged) - Mouse folate receptor 1 (adult) (Folr1) |
CNY 4470.00 |