Fxn (NM_008044) Mouse Untagged Clone
CAT#: MC208509
Fxn (untagged) - Mouse frataxin (Fxn), nuclear gene encoding mitochondrial protein, (10ug)
CNY 2400.00
CNY 3990.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | FA; FARR; Frda; X25 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208509 representing NM_008044
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGGCGTTCGGAGGTCGCGCAGCCGTGGGCTTGCTGCCCCGGACGGCGTCCCGGGCCTCCGCCTGGG TCGGGAACCCGCGCTGGAGGGAACCGATCGTAACCTGCGGCCGCCGAGGCCTACATGTCACAGTCAACGC CGGCGCCACCCGCCACGCCCATTTGAACCTCCACTACCTCCAGATTCTGAACATCAAAAAGCAGAGCGTC TGCGTGGTGCATTTGAGGAACTTGGGGACATTGGACAACCCAAGCTCTCTAGACGAGACAGCGTATGAAA GACTGGCGGAAGAGACCCTGGACTCCCTGGCCGAGTTCTTTGAAGACCTCGCAGACAAGCCCTATACCCT GGAGGACTACGATGTCTCTTTTGGGGATGGCGTGCTCACCATTAAGCTGGGCGGGGATCTAGGGACCTAC GTGATCAACAAGCAGACCCCAAACAAGCAAATCTGGCTGTCTTCTCCTTCCAGCGGCCCCAAGCGCTATG ACTGGACCGGGAAGAACTGGGTGTACTCTCATGACGGCGTGTCTCTGCATGAGCTGCTGGCCAGGGAGCT GACTAAAGCTTTAAACACCAAACTGGACTTGTCTTCATTGGCCTATTCTGGAAAAGGCACTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_008044 |
Insert Size | 624 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_008044.2, NP_032070.1 |
RefSeq Size | 1095 bp |
RefSeq ORF | 624 bp |
Locus ID | 14297 |
UniProt ID | O35943 |
Gene Summary | Promotes the biosynthesis of heme and assembly and repair of iron-sulfur clusters by delivering Fe(2+) to proteins involved in these pathways. May play a role in the protection against iron-catalyzed oxidative stress through its ability to catalyze the oxidation of Fe(2+) to Fe(3+); the oligomeric form but not the monomeric form has in vitro ferroxidase activity. May be able to store large amounts of iron in the form of a ferrihydrite mineral by oligomerization. Modulates the RNA-binding activity of ACO1 (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Mice harboring the FXN I151F pathological point mutation present decreased frataxin levels, a Friedreich ataxia-like phenotype, and mitochondrial alterations
,null,
Cellular and Molecular Life Sciences
,PubMed ID 35038030
[Fxn]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224586 | Fxn (tGFP-tagged) - Mouse frataxin (Fxn) nuclear gene encoding mitochondrial protein, (10ug) |
CNY 2850.00 |
|
MR224586 | Fxn (Myc-DDK-tagged) - Mouse frataxin (Fxn), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |
|
MR224586L3 | Lenti ORF clone of Fxn (Myc-DDK-tagged) - Mouse frataxin (Fxn), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
MR224586L4 | Lenti ORF clone of Fxn (mGFP-tagged) - Mouse frataxin (Fxn), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |