Gng4 (NM_010317) Mouse Untagged Clone
CAT#: MC208572
Gng4 (untagged) - Mouse guanine nucleotide binding protein (G protein), gamma 4 (Gng4), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208572 representing NM_010317
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGGAAGGCATGTCTAATAACAGCACCACCAGCATCTCCCAGGCCAGGAAAGCCGTGGAGCAGCTGA AGATGGAAGCCTGCATGGACAGGGTGAAGGTCTCCCAGGCTGCCTCAGACCTCCTGGCCTACTGTGAAGC CCACGTGCGGGAGGACCCCCTCATCATCCCAGTGCCTGCCTCAGAAAACCCCTTCCGGGAGAAGAAGTTC TTCTGCACCATCCTCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010317 |
Insert Size | 228 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_010317.3, NP_034447.1 |
RefSeq Size | 3200 bp |
RefSeq ORF | 228 bp |
Locus ID | 14706 |
UniProt ID | P50153 |
Gene Summary | This gene encodes the gamma subunit of the heterotrimeric G-proteins that are comprised of alpha, beta and gamma subunits. Upon activation by G protein-coupled receptors, the beta-gamma heterodimer dissociates from the alpha subunit to activate downstream signaling events. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (1) represents the longer transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200100 | Gng4 (tGFP-tagged) - Mouse guanine nucleotide binding protein (G protein), gamma 4 subunit (Gng4) |
CNY 2850.00 |
|
MR200100 | Gng4 (Myc-DDK-tagged) - Mouse guanine nucleotide binding protein (G protein), gamma 4 (Gng4) |
CNY 1200.00 |
|
MR200100L3 | Lenti ORF clone of Gng4 (Myc-DDK-tagged) - Mouse guanine nucleotide binding protein (G protein), gamma 4 (Gng4) |
CNY 4750.00 |
|
MR200100L4 | Lenti ORF clone of Gng4 (mGFP-tagged) - Mouse guanine nucleotide binding protein (G protein), gamma 4 (Gng4) |
CNY 4750.00 |