H2-Ea-ps (NM_010381) Mouse Untagged Clone

CAT#: MC208624

H2 (untagged) - Mouse histocompatibility 2, class II antigen E alpha, pseudogene (H2-Ea-ps), (10ug)



  "NM_010381" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI323765; E-alpha-f; H-2Ea; H2-Ea; I-Ealpha; Ia-3; Ia3; MHC-H2-Ea
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208624 representing NM_010381
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCACAATTGGAGCCCTGCTGTTAAGATTTTTCTTCATTGCTGTTCTGATGAGCTCCCAGAAGTCAT
GGGCTATCAAAGAGGAACACACCATCATCCAGGCGGAGTTCTATCTTTTACCAGACAAACGTGGAGAGTT
TATGTTTGACTTTGACGGCGATGAGATTTTCCATGTAGACATTGAAAAGTCAGAGACCATCTGGAGACTT
GAAGAATTTGCAAAGTTTGCCAGCTTTGAGGCTCAGGGTGCACTGGCTAATATAGCTGTGGACAAAGCTA
ACCTGGATGTCATGAAAGAGCGTTCCAACAACACTCCAGATGCCAACGTGGCCCCAGAGGTGACTGTACT
CTCCAGAAGCCCTGTGAACCTGGGAGAGCCCAACATCCTCATCTGTTTCATTGACAAGTTCTCCCCTCCA
GTGGTCAATGTCACCTGGTTCCGGAATGGACGGCCTGTCACCGAAGGCGTGTCAGAGACAGTGTTTCTCC
CGAGGGACGATCACCTCTTCCGCAAATTCCACTATCTGACCTTCCTGCCCTCCACAGATGATTTCTATGA
CTGTGAGGTGGATCACTGGGGTTTGGAGGAGCCTCTGCGGAAGCACTGGGAGTTTGAAGAGAAAACCCTC
CTCCCAGAAACTACAGAGAATGTCGTGTGTGCTCTTGGGTTGTTTGTGGGTCTGGTGGGCATCGTTGTGG
GGATTATCCTCATCATGAAGGGTATTAAAAAACGCAATGTTGTAGAACGCCGACAAGGAGCCCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010381
Insert Size 768 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_010381.2, NP_034511.2
RefSeq Size 887 bp
RefSeq ORF 768 bp
Locus ID 100504404
UniProt ID P04224
Gene Summary This locus belongs to the class II major histocompatibility complex (MHC) family of genes, which encode immune response (Ia) antigens that function in the T-cell-dependent immune response. This family member has multiple haplotypes, some of which result in the production of an E-alpha subunit that combines with an E-beta subunit to form a functional E complex at the cell surface. Other haplotypes, including that of the reference genome allele, contain mutations and they thus represent polymorphic pseudogenes that do not produce functional products. These mutations include frameshifting indels, nonsense mutations, and deletions of larger regions. The reference genome haplotype contains a deletion at the 5' end of the gene, including the core promoter region and the transcription start site, and therefore no transcripts result from this haplotype. [provided by RefSeq, Aug 2011]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...