Igf2 (NM_010514) Mouse Untagged Clone
CAT#: MC208758
Igf2 (untagged) - Mouse insulin-like growth factor 2 (Igf2), transcript variant 1, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AL033362; Igf; Igf-; Igf-2; Igf-II; M; M6; M6pr; Mpr; Peg; Peg2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208758 representing NM_010514
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCGGCAGCGTCGCCGGCTTCCAGGTACCAATGGGGATCCCAGTGGGGAAGTCGATGTTGGTGCTTC TCATCTCTTTGGCCTTCGCCTTGTGCTGCATCGCTGCTTACGGCCCCGGAGAGACTCTGTGCGGAGGGGA GCTTGTTGACACGCTTCAGTTTGTCTGTTCGGACCGCGGCTTCTACTTCAGCAGGCCTTCAAGCCGTGCC AACCGTCGCAGCCGTGGCATCGTGGAAGAGTGCTGCTTCCGCAGCTGCGACCTGGCCCTCCTGGAGACAT ACTGTGCCACCCCCGCCAAGTCCGAGAGGGACGTGTCTACCTCTCAGGCCGTACTTCCGGACGACTTCCC CAGATACCCCGTGGGCAAGTTCTTCCAATATGACACCTGGAGACAGTCCGCGGGACGCCTGCGCAGAGGC CTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCGCATGCTTGCCAAAGAGCTCAAAGAGTTCAGAGAGGCCA AACGTCATCGTCCCCTGATCGTGTTACCACCCAAAGACCCCGCCCACGGGGGAGCCTCTTCGGAGATGTC CAGCAACCATCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010514 |
Insert Size | 576 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_010514.3, NP_034644.2 |
RefSeq Size | 4038 bp |
RefSeq ORF | 576 bp |
Locus ID | 16002 |
UniProt ID | P09535 |
Gene Summary | This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. It is an imprinted gene that is expressed only from the paternal allele. The encoded protein undergoes proteolytic processing to generate a mature peptide. The transgenic overexpression of this gene in mice results in prenatal overgrowth, polyhydramnios, fetal and neonatal lethality, disproportionate organ overgrowth including tongue enlargement, and skeletal abnormalities. Mice lacking the encoded protein exhibit growth deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). This isoform (1) may undergo proteolytic processing similar to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to extend the N-terminus. The use of an alternative upstream start codon would result in a protein that is 11 aa longer. This upstream AUG has a stronger Kozak signal than the downstream site and and appears to be rodent-specific, but according to the software program SignalP3.0, the 11 additional amino acids are not predicted to disrupt cleavage of the signal peptide. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223626 | Igf2 (tGFP-tagged) - Mouse insulin-like growth factor 2 (Igf2) transcript variant 1, (10ug) |
CNY 5440.00 |
|
MR223626 | Igf2 (Myc-DDK-tagged) - Mouse insulin-like growth factor 2 (Igf2), transcript variant 1 |
CNY 1900.00 |
|
MR223626L1 | Lenti ORF clone of Igf2 (Myc-DDK-tagged) - Mouse insulin-like growth factor 2 (Igf2), transcript variant 1 |
CNY 3800.00 |
|
MR223626L2 | Lenti ORF clone of Igf2 (mGFP-tagged) - Mouse insulin-like growth factor 2 (Igf2), transcript variant 1 |
CNY 6240.00 |
|
MR223626L3 | Lenti ORF clone of Igf2 (Myc-DDK-tagged) - Mouse insulin-like growth factor 2 (Igf2), transcript variant 1 |
CNY 3800.00 |
|
MR223626L4 | Lenti ORF clone of Igf2 (mGFP-tagged) - Mouse insulin-like growth factor 2 (Igf2), transcript variant 1 |
CNY 3800.00 |