Il17a (NM_010552) Mouse Untagged Clone
CAT#: MC208774
Il17a (untagged) - Mouse interleukin 17A (Il17a), (10ug)
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Ctl; Ctla; Ctla-8; Ctla8; Il; IL-; IL-17; IL-17A; Il17 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208774 representing NM_010552
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGTCCAGGGAGAGCTTCATCTGTGTCTCTGATGCTGTTGCTGCTGCTGAGCCTGGCGGCTACAGTGA AGGCAGCAGCGATCATCCCTCAAAGCTCAGCGTGTCCAAACACTGAGGCCAAGGACTTCCTCCAGAATGT GAAGGTCAACCTCAAAGTCTTTAACTCCCTTGGCGCAAAAGTGAGCTCCAGAAGGCCCTCAGACTACCTC AACCGTTCCACGTCACCCTGGACTCTCCACCGCAATGAAGACCCTGATAGATATCCCTCTGTGATCTGGG AAGCTCAGTGCCGCCACCAGCGCTGTGTCAATGCGGAGGGAAAGCTGGACCACCACATGAATTCTGTTCT CATCCAGCAAGAGATCCTGGTCCTGAAGAGGGAGCCTGAGAGCTGCCCCTTCACTTTCAGGGTCGAGAAG ATGCTGGTGGGTGTGGGCTGCACCTGCGTGGCCTCGATTGTCCGCCAGGCAGCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010552 |
Insert Size | 477 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC119303, AAI19304 |
RefSeq Size | 569 bp |
RefSeq ORF | 477 bp |
Locus ID | 16171 |
UniProt ID | Q62386 |
Gene Summary | This gene encodes a pro-inflammatory cytokine that is a member of the interleukin-17 family. The encoded protein plays a central role in host defense against diverse pathogens. The encoded protein is produced by activated T-cells and certain cell types of innate immune system. The active protein functions as either a homodimer with other interleukin-17 family members and signals through the interleukin-17 receptor to induce inflammatory cytokine production. Aberrant expression of this gene is associated with autoinflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis. [provided by RefSeq, Sep 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227682 | Il17a (tGFP-tagged) - Mouse interleukin 17A (Il17a), (10ug) |
CNY 2850.00 |
|
MR227682 | Il17a (Myc-DDK-tagged) - Mouse interleukin 17A (Il17a) |
CNY 1200.00 |
|
MR227682L3 | Lenti ORF clone of Il17a (Myc-DDK-tagged) - Mouse interleukin 17A (Il17a) |
CNY 3600.00 |
|
MR227682L4 | Lenti ORF clone of Il17a (mGFP-tagged) - Mouse interleukin 17A (Il17a) |
CNY 3600.00 |