Il1r2 (NM_010555) Mouse Untagged Clone
CAT#: MC208776
Il1r2 (untagged) - Mouse interleukin 1 receptor, type II (Il1r2), (10ug)
CNY 3656.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | CD121b; Il1r-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208776 representing NM_010555
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_010555 |
Insert Size | 1233 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_010555.4, NP_034685.1 |
RefSeq Size | 1360 bp |
RefSeq ORF | 1233 bp |
Locus ID | 16178 |
UniProt ID | P27931 |
Gene Summary | Non-signaling receptor for IL1A, IL1B and IL1RN. Reduces IL1B activities. Serves as a decoy receptor by competetive binding to IL1B and preventing its binding to IL1R1. Also modulates cellular response through non-signaling association with IL1RAP after binding to IL1B. IL1R2 (membrane and secreted forms) preferentially binds IL1B and poorly IL1A and IL1RN. The secreted IL1R2 recruits secreted IL1RAP with high affinity; this complex formation may be the dominant mechanism for neutralization of IL1B by secreted/soluble receptors (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220951 | Il1r2 (tGFP-tagged) - Mouse interleukin 1 receptor type II (Il1r2), (10ug) |
CNY 3140.00 |
|
MR220951 | Il1r2 (Myc-DDK-tagged) - Mouse interleukin 1 receptor, type II (Il1r2) |
CNY 3656.00 |
|
MR220951L3 | Lenti ORF clone of Il1r2 (Myc-DDK-tagged) - Mouse interleukin 1 receptor, type II (Il1r2) |
CNY 4750.00 |
|
MR220951L4 | Lenti ORF clone of Il1r2 (mGFP-tagged) - Mouse interleukin 1 receptor, type II (Il1r2) |
CNY 4750.00 |