United States
Germany
Japan
United Kingdom
China
Il4 (NM_021283) Mouse Untagged Clone
CAT＃: MC208783
Il4 (untagged) - Mouse interleukin 4 (Il4), transcript variant 1, (10ug)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | BSF-1; Il-4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208783 representing NM_021283
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGTCTCAACCCCCAGCTAGTTGTCATCCTGCTCTTCTTTCTCGAATGTACCAGGAGCCATATCCACG GATGCGACAAAAATCACTTGAGAGAGATCATCGGCATTTTGAACGAGGTCACAGGAGAAGGGACGCCATG CACGGAGATGGATGTGCCAAACGTCCTCACAGCAACGAAGAACACCACAGAGAGTGAGCTCGTCTGTAGG GCTTCCAAGGTGCTTCGCATATTTTATTTAAAACATGGGAAAACTCCATGCTTGAAGAAGAACTCTAGTG TTCTCATGGAGCTGCAGAGACTCTTTCGGGCTTTTCGATGCCTGGATTCATCGATAAGCTGCACCATGAA TGAGTCCAAGTCCACATCACTGAAAGACTTCCTGGAAAGCCTAAAGAGCATCATGCAAATGGATTACTCG TAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_021283 |
| Insert Size | 423 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC027514, AAH27514 |
| RefSeq Size | 584 bp |
| RefSeq ORF | 423 bp |
| Locus ID | 16189 |
| UniProt ID | P07750 |
| Gene Summary | Participates in at least several B-cell activation processes as well as of other cell types (PubMed:3083412). It is a costimulator of DNA-synthesis. It induces the expression of class II MHC molecules on resting B-cells (PubMed:3498301). It enhances both secretion and cell surface expression of IgE and IgG1 (PubMed:3498301). It also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Positively regulates IL31RA expression in macrophages (PubMed:25847241). Stimulates autophagy in dendritic cells by interfering with mTORC1 signaling and through the induction of RUFY4 (PubMed:26416964).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG226748 | Il4 (tGFP-tagged) - Mouse interleukin 4 (Il4) transcript variant 1, (10ug) |
CNY 2,800.00 |
|
| MR226748 | Il4 (Myc-DDK-tagged) - Mouse interleukin 4 (Il4), transcript variant 1 |
CNY 1,200.00 |
|
| MR226748L3 | Lenti ORF clone of Il4 (Myc-DDK-tagged) - Mouse interleukin 4 (Il4), transcript variant 1 |
CNY 3,600.00 |
|
| MR226748L4 | Lenti ORF clone of Il4 (mGFP-tagged) - Mouse interleukin 4 (Il4), transcript variant 1 |
CNY 3,600.00 |
