Ldhb (NM_008492) Mouse Untagged Clone
CAT#: MC208874
Ldhb (untagged) - Mouse lactate dehydrogenase B (Ldhb), (10ug)
CNY 5488.00
Product images
                    
                Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | AI790582; H-Ld; H-Ldh; Ldh-; Ldh-2; LDH-B; LDH-H; Ldh2 | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >MC208874 representing NM_008492 
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAACCCTTAAGGAGAAGCTCATTGCGTCCGTTGCAGATGATGAGGCTGCCGTCCCGAACAACAAGA TCACTGTAGTGGGCGTTGGACAAGTGGGTATGGCATGTGCCATCAGCATTCTGGGAAAGTCTCTGGCTGA TGAACTTGCCCTGGTGGATGTGTTGGAAGACAAGCTCAAAGGAGAGATGATGGACCTGCAGCACGGGAGC TTGTTCCTCCAGACTCCGAAAATTGTGGCCGATAAAGATTACTCTGTGACAGCCAACTCTAAGATTGTGG TGGTGACGGCAGGAGTCCGCCAGCAGGAGGGGGAGAGTCGGCTCAACCTGGTGCAGAGAAATGTCAACGT GTTCAAGTTCATCATTCCTCAGATCGTCAAGTACAGCCCTGACTGCACCATCATCGTGGTTTCCAACCCA GTGGATATTCTGACTTACGTCACCTGGAAACTGAGCGGGCTACCTAAGCACCGTGTGATTGGAAGCGGAT GCAATCTGGATTCTGCTCGATTCCGCTACCTCATGGCAGAGAAGCTTGGCATTCATCCCAGCAGCTGCCA CGGATGGATCCTGGGCGAGCATGGAGACTCCAGTGTGGCTGTGTGGAGCGGGGTGAATGTGGCAGGAGTC TCCCTCCAGGAACTGAATCCAGAAATGGGGACAGACAATGACAGTGAGAACTGGAAGGAGGTGCATAAGA TGGTGGTGGACAGTGCCTATGAAGTCATCAAGCTCAAAGGCTACACCAACTGGGCCATCGGCCTGAGCGT GGCTGACCTCATCGAGTCCATGCTGAAAAACCTCTCCCGGATTCACCCCGTGTCTACCATGGTGAAGGGA ATGTACGGCATTGAGAATGAAGTCTTCCTCAGTCTCCCGTGCATCCTCAATGCTCGGGGGCTGACCAGCG TCATCAATCAGAAGCTGAAGGACGATGAGGTCGCTCAGCTCAGGAAGAGTGCGGACACCCTGTGGGACAT CCAGAAAGACCTCAAAGACCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA  | 
        
| Chromatograms | 
                CHROMATOGRAMS
                ![]() Sequencher program is needed, download here.  | 
        
| Restriction Sites | SgfI-MluI | 
| ACCN | NM_008492 | 
| Insert Size | 1005 bp | 
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info  | 
        
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | BC046755, AAH46755 | 
| RefSeq Size | 1324 bp | 
| RefSeq ORF | 1005 bp | 
| Locus ID | 16832 | 
| UniProt ID | P16125 | 
| Gene Summary | This gene encodes the B subunit of lactate dehydrogenase enzyme, which catalyzes the interconversion of pyruvate and lactate with concomitant interconversion of NADH and NAD+ in a post-glycolysis process. Alternatively spliced transcript variants have also been found for this gene. Recent studies have shown that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Pseudogenes have been identified on chromosomes 1 and 19. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (Ldhb) results from translation termination at the upstream UGA stop codon, while the longer isoform (Ldhbx) results from UGA stop codon readthrough to the downstream UAG termination codon. This RefSeq represents the shorter isoform (Ldhb), which is localized in the cytosol.  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG204957 | Ldhb (tGFP-tagged) - Mouse lactate dehydrogenase B (Ldhb) | 
                                                     CNY 5256.00  | 
                                            |
| MR204957 | Ldhb (Myc-DDK-tagged) - Mouse lactate dehydrogenase B (Ldhb) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 3656.00  | 
                                            |
| MR204957L3 | Lenti ORF clone of Ldhb (Myc-DDK-tagged) - Mouse lactate dehydrogenase B (Ldhb) | 
                                                     CNY 6056.00  | 
                                            |
| MR204957L4 | Lenti ORF clone of Ldhb (mGFP-tagged) - Mouse lactate dehydrogenase B (Ldhb) | 
                                                     CNY 6056.00  | 
                                            

