Lif (NM_001039537) Mouse Untagged Clone
CAT#: MC208888
Lif (untagged) - Mouse leukemia inhibitory factor (Lif), transcript variant 2, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208888 representing NM_001039537
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAACCAGATCAAGAATCAACTGGCACAGCTCAATGGCAGCGCCAATGCTCTCTTCATTTCCTATTACA CAGCTCAAGGGGAGCCGTTTCCCAACAACGTGGAAAAGCTATGTGCGCCTAACATGACAGACTTCCCATC TTTCCATGGCAACGGGACAGAGAAGACCAAGTTGGTGGAGCTGTATCGGATGGTCGCATACCTGAGCGCC TCCCTGACCAATATCACCCGGGACCAGAAGGTCCTGAACCCCACTGCCGTGAGCCTCCAGGTCAAGCTCA ATGCTACTATAGACGTCATGAGGGGCCTCCTCAGCAATGTGCTTTGCCGTCTGTGCAACAAGTACCGTGT GGGCCACGTGGATGTGCCACCTGTCCCCGACCACTCTGACAAAGAAGCCTTCCAAAGGAAAAAGTTGGGT TGCCAGCTTCTGGGGACATACAAGCAAGTCATAAGTGTGGTGGTCCAGGCCTTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039537 |
Insert Size | 477 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001039537.2, NP_001034626.1 |
RefSeq Size | 4114 bp |
RefSeq ORF | 477 bp |
Locus ID | 16878 |
UniProt ID | P09056 |
Gene Summary | LIF has the capacity to induce terminal differentiation in leukemic cells. Its activities include the induction of hematopoietic differentiation in normal and myeloid leukemia cells, the induction of neuronal cell differentiation, and the stimulation of acute-phase protein synthesis in hepatocytes.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223901 | Lif (tGFP-tagged) - Mouse leukemia inhibitory factor (Lif) transcript variant 2, (10ug) |
CNY 2850.00 |
|
MR223901 | Lif (Myc-DDK-tagged) - Mouse leukemia inhibitory factor (Lif), transcript variant 2 |
CNY 1200.00 |
|
MR223901L3 | Lenti ORF clone of Lif (Myc-DDK-tagged) - Mouse leukemia inhibitory factor (Lif), transcript variant 2 |
CNY 4750.00 |
|
MR223901L4 | Lenti ORF clone of Lif (mGFP-tagged) - Mouse leukemia inhibitory factor (Lif), transcript variant 2 |
CNY 4750.00 |