Myl2 (NM_010861) Mouse Untagged Clone
CAT#: MC209006
Myl2 (untagged) - Mouse myosin, light polypeptide 2, regulatory, cardiac, slow (Myl2), (10ug)
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | MLC-2; MLC-2s/v; MLC-2v; Mlc2v; Mylpc |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209006 representing NM_010861
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCACCAAAGAAAGCCAAGAAGCGGATAGAAGGCGGGAGCTCCAACGTGTTCTCCATGTTTGAGCAGA CCCAGATCCAGGAGTTCAAGGAAGCCTTCACAATCATGGACCAGAACAGAGACGGCTTCATCGACAAGAA TGACCTAAGGGACACATTTGCTGCCCTAGGACGAGTGAACGTGAAAAATGAAGAGATCGATGAAATGATC AAAGAGGCTCCAGGTCCAATTAACTTCACCGTGTTCCTCACGATGTTTGGGGAGAAACTTAAAGGGGCTG ATCCTGAAGAGACCATTCTCAACGCATTCAAGGTGTTTGATCCCGAGGGCAAAGGGTCACTGAAGGCTGA CTATGTCCGGGAGATGCTGACCACACAAGCAGGGAGGTTCTCCAAAGAGGAGATCGACCAGATGTTCGCA GCCTTTCCCCCTGACGTCACCGGCAATCTTGATTATAAGAATTTGGTCCACATCATTACCCACGGAGAAG AGAAGGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_010861 |
Insert Size | 501 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC061144, AAH61144 |
RefSeq Size | 633 bp |
RefSeq ORF | 501 bp |
Locus ID | 17906 |
UniProt ID | P51667 |
Gene Summary | Contractile protein that plays a role in heart development and function (PubMed:10409661). Following phosphorylation, plays a role in cross-bridge cycling kinetics and cardiac muscle contraction by increasing myosin lever arm stiffness and promoting myosin head diffusion; as a consequence of the increase in maximum contraction force and calcium sensitivity of contraction force. These events altogether slow down myosin kinetics and prolong duty cycle resulting in accumulated myosins being cooperatively recruited to actin binding sites to sustain thin filament activation as a means to fine-tune myofilament calcium sensitivity to force (By similarity) (PubMed:22426213, PubMed:16908724, PubMed:10409661). During cardiogenesis plays an early role in cardiac contractility by promoting cardiac myofibril assembly (PubMed:9422794).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201346 | Myl2 (tGFP-tagged) - Mouse myosin, light polypeptide 2, regulatory, cardiac, slow (Myl2) |
CNY 5200.00 |
|
MR201346 | Myl2 (Myc-DDK-tagged) - Mouse myosin, light polypeptide 2, regulatory, cardiac, slow (Myl2) |
CNY 3600.00 |
|
MR201346L3 | Lenti ORF clone of Myl2 (Myc-DDK-tagged) - Mouse myosin, light polypeptide 2, regulatory, cardiac, slow (Myl2) |
CNY 5890.00 |
|
MR201346L4 | Lenti ORF clone of Myl2 (mGFP-tagged) - Mouse myosin, light polypeptide 2, regulatory, cardiac, slow (Myl2) |
CNY 5890.00 |