Sept2 (NM_001159718) Mouse Untagged Clone
CAT#: MC209019
41519 (untagged) - Mouse septin 2 (Sept2), transcript variant 4, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AW208991; mKIAA0158; Nedd-5; Nedd5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209019 representing NM_001159718
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGGTTGGTGAATCTGGTCTAGGAAAATCAACTCTCATAAACAGCTTATTCCTGACTGATCTCTACC CAGAAAGAATTATTCCTGGAGCTGCAGAGAAAATTGAAAGAACTGTCCAGATAGAGGCTTCGACTGTTGA GATTGAAGAGCGGGGTGTGAAGCTGCGGCTTACAGTAGTGGACACTCCCGGCTACGGGGATGCCATCAAC TGCAGGGATTGTTTCAAGACAATTATCTCCTACATTGATGAGCAGTTTGAACGCTACCTACATGATGAGA GTGGACTGAACAGGCGTCACATCATTGATAACAGGGTACATTGTTGCTTCTACTTCATTTCACCTTTTGG ACATGGACTGAAGCCCTTAGATGTTGCATTTATGAAAGCGATACACAATAAGGTGAATATTGTGCCTGTC ATTGCGAAAGCTGACACTCTCACTCTGAAGGAGCGTGAGCGGCTTAAGAAAAGGATTTTGGATGAAATTG AAGAGCATAGCATTAAAATCTATCACTTACCTGATGCAGAGTCAGATGAAGATGAAGACTTTAAGGAGCA GACTAGACTCCTCAAGGCCAGTATCCCATTCTCTGTGGTTGGCTCCAACCAGTTGATTGAAGCCAAAGGC AAGAAGGTTAGAGGCCGTCTCTACCCATGGGGTGTTGTAGAGGTGGAGAACCCAGAACACAATGACTTTC TGAAGCTGAGAACGATGCTCATCACCCACATGCAGGACCTACAGGAAGTGACCCAAGACCTTCACTATGA AAACTTCCGTTCTGAGAGGCTGAAGAGAGGCGGCAGGAAAGTAGAGAATGAGGACATGAATAAAGACCAG ATCTTGCTTGAAAAGGAGGCTGAGCTCCGCCGCATGCAAGAGATGATTGCAAGAATGCAAGCGCAGATGC AGATGCAGATGCAGGGTGGTGACAGTGACAGCGGGGCTCTCGGGCAGCATGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001159718 |
Insert Size | 966 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001159718.1, NP_001153190.1 |
RefSeq Size | 3192 bp |
RefSeq ORF | 966 bp |
Locus ID | 18000 |
UniProt ID | P42208 |
Gene Summary | Filament-forming cytoskeletal GTPase. Forms a filamentous structure with SEPTIN12, SEPTIN6, SEPTIN2 and probably SEPTIN4 at the sperm annulus which is required for the structural integrity and motility of the sperm tail during postmeiotic differentiation (By similarity). Required for normal organization of the actin cytoskeleton. Plays a role in the biogenesis of polarized columnar-shaped epithelium by maintaining polyglutamylated microtubules, thus facilitating efficient vesicle transport, and by impeding MAP4 binding to tubulin. Required for the progression through mitosis. Forms a scaffold at the midplane of the mitotic splindle required to maintain CENPE localization at kinetochores and consequently chromosome congression. During anaphase, may be required for chromosome segregation and spindle elongation. Plays a role in ciliogenesis and collective cell movements (By similarity). In cilia, required for the integrity of the diffusion barrier at the base of the primary cilium that prevents diffusion of transmembrane proteins between the cilia and plasma membranes: probably acts by regulating the assembly of the tectonic-like complex (also named B9 complex) by localizing TMEM231 protein.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. This variant lacks full-length transcript support in mouse, but it is supported by partial mouse ESTs and by the full-length orangutan mRNA, CR860673.1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225545 | 41519 (tGFP-tagged) - Mouse septin 2 (Sept2) transcript variant 4, (10ug) |
CNY 2850.00 |
|
MR225545 | 41519 (Myc-DDK-tagged) - Mouse septin 2 (Sept2), transcript variant 4 |
CNY 2400.00 |
|
MR225545L3 | Lenti ORF clone of 41519 (Myc-DDK-tagged) - Mouse septin 2 (Sept2), transcript variant 4 |
CNY 4750.00 |
|
MR225545L4 | Lenti ORF clone of 41519 (mGFP-tagged) - Mouse septin 2 (Sept2), transcript variant 4 |
CNY 4750.00 |