Ngfr (NM_033217) Mouse Untagged Clone
CAT#: MC209033
Ngfr (untagged) - Mouse nerve growth factor receptor (TNFR superfamily, member 16) (Ngfr), (10ug)
CNY 5488.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | LNGFR; p75; p75NGFR; p75NTR; Tnfrsf16 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209033 representing NM_033217
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGAGGGCAGGTGCTGCCTGCAGCGCCATGGACCGGCTGCGCCTGCTGCTGCTGCTGCTGCTGCTTC TAGGGGTGTCCTTTGGAGGTGCCAAGGAGACATGTTCCACAGGCATGTACACCCACAGTGGAGAGTGCTG CAAAGCCTGCAACCTGGGCGAAGGTGTGGCCCAGCCTTGCGGAGCCAACCAGACCGTGTGTGAACCCTGC CTGGACAGTGTTACGTTCTCTGACGTGGTGAGCGCCACCGAGCCGTGCAAGCCGTGCACCGAGTGCCTGG GCCTGCAGAGTATGTCCGCTCCCTGTGTGGAGGCAGACGATGCCGTGTGCCGATGCTCCTATGGCTACTA CCAGGACGAGGAGACTGGCCGCTGCGAGGCTTGCAGCGTGTGCGGGGTGGGCTCAGGACTCGTGTTCTCC TGCCAGGACAAACAGAACACAGTGTGTGAAGAGTGCCCAGAGGGCACATACTCAGATGAAGCCAACCACG TGGACCCGTGCCTACCCTGCACGGTGTGCGAGGACACTGAGCGCCAGTTACGCGAGTGCACGCCCTGGGC TGACGCCGAATGCGAGGAGATCCCTGGCCGATGGATCACAAGGTCTACGCCCCCGGAGGGCTCTGACGTC ACAACACCCAGCACCCAGGAGCCGGAGGCACCTCCAGAGCGAGACCTCATAGCCAGCACAGTGGCCGATA CGGTGACCACTGTGATGGGCAGCTCCCAGCCTGTAGTGACCCGAGGCACCGCTGACAACCTCATTCCTGT CTATTGCTCCATCTTGGCTGCTGTGGTTGTGGGCCTTGTGGCCTATATTGCTTTCAAGAGATGGAACAGC TGCAAGCAAAATAAACAAGGAGCCAACAGCCGGCCGGTGAACCAGACACCCCCACCAGAGGGAGAGAAAC TGCACAGCGACAGCGGCATCTCTGTGGACAGCCAGAGCCTGCACGACCAGCAGACCCACACACAGACTGC CTCAGGCCAAGCCCTCAAGGGTGATGGCAACCTCTACAGTAGCCTGCCCCTGACCAAGCGTGAGGAGGTC GAGAAGCTGCTCAATGGTGACACCTGGCGACATCTGGCAGGCGAGCTGGGCTACCAGCCGGAGCATATAG ACTCCTTTACCCACGAGGCCTGCCCAGTCCGAGCCCTGCTGGCCAGCTGGGGTGCCCAGGACAGCGCGAC GCTCGATGCCCTTTTAGCCGCCCTGCGACGCATCCAGAGAGCTGACATTGTGGAGAGCCTGTGCAGCGAG TCCACTGCCACGTCCCCTGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_033217 |
Insert Size | 1284 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC038365, AAH38365 |
RefSeq Size | 3441 bp |
RefSeq ORF | 1284 bp |
Locus ID | 18053 |
UniProt ID | Q9Z0W1 |
Gene Summary | Low affinity neurotrophin receptor which can bind to mature NGF, BDNF, NTF3, and NTF4 (PubMed:11559852, PubMed:1317267). Forms a heterodimeric receptor with SORCS2 that binds the precursor forms of NGF (proNGF), BDNF (proBDNF) and NTF3 (proNT3) with high affinity, and has much lower affinity for mature NGF and BDNF (PubMed:22155786, PubMed:24908487, PubMed:27457814). Plays an important role in differentiation and survival of specific neuronal populations during development (PubMed:1317267, PubMed:11559852). Can mediate cell survival as well as cell death of neural cells (PubMed:1317267, PubMed:11559852, PubMed:24908487). The heterodimeric receptor formed with SORCS2 plays a role in proBDNF-dependent synaptic plasticity, in hippocampal long term depression (LTD) and long term potentiation (LTP) (PubMed:27457814). Plays a role in the inactivation of RHOA (By similarity). Plays a role in the regulation of the translocation of GLUT4 to the cell surface in adipocytes and skeletal muscle cells in response to insulin, probably by regulating RAB31 activity, and thereby contributes to the regulation of insulin-dependent glucose uptake (PubMed:22460790). Necessary for the circadian oscillation of the clock genes ARNTL/BMAL1, PER1, PER2 and NR1D1 in the suprachiasmatic nucleus (SCN) of the brain and in liver and of the genes involved in glucose and lipid metabolism in the liver (PubMed:23785138).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226206 | Ngfr (tGFP-tagged) - Mouse nerve growth factor receptor (TNFR superfamily member 16) (Ngfr), (10ug) |
CNY 7088.00 |
|
MR226206 | Ngfr (Myc-DDK-tagged) - Mouse nerve growth factor receptor (TNFR superfamily, member 16) (Ngfr) |
CNY 5488.00 |
|
MR226206L1 | Lenti ORF clone of Ngfr (Myc-DDK-tagged) - Mouse nerve growth factor receptor (TNFR superfamily, member 16) (Ngfr) |
CNY 6180.00 |
|
MR226206L2 | Lenti ORF clone of Ngfr (mGFP-tagged) - Mouse nerve growth factor receptor (TNFR superfamily, member 16) (Ngfr) |
CNY 7888.00 |
|
MR226206L3 | Lenti ORF clone of Ngfr (Myc-DDK-tagged) - Mouse nerve growth factor receptor (TNFR superfamily, member 16) (Ngfr) |
CNY 7888.00 |
|
MR226206L4 | Lenti ORF clone of Ngfr (mGFP-tagged) - Mouse nerve growth factor receptor (TNFR superfamily, member 16) (Ngfr) |
CNY 7888.00 |