Cd244 (NM_018729) Mouse Untagged Clone

CAT#: MC209044

Cd244 (untagged) - Mouse CD244 natural killer cell receptor 2B4 (Cd244), (10ug)



  "NM_018729" in other vectors (6)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2B4; C9.1; F730046O15Rik; Ly90; NAIL; NKR2B4; Nmrk; SLAMF4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209044 representing NM_018729
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTGGGGCAAGCTGTCCTGTTCACAACCTTTCTGCTCCTCAGGGCTCATCAGGGCCAAGACTGCCCAG
ATTCTTCTGAAGAAGTGGTTGGTGTCTCAGGAAAGCCTGTCCAGCTGAGGCCTTCCAACATACAGACAAA
AGATGTTTCTGTTCAATGGAAGAAGACAGAACAGGGCTCACACAGAAAAATTGAGATCCTGAATTGGTAT
AATGATGGTCCCAGTTGGTCAAATGTATCTTTTAGTGATATCTATGGTTTTGATTATGGGGATTTTGCTC
TTAGTATCAAGTCAGCTAAGCTGCAAGACAGTGGTCACTACCTGCTGGAGATCACCAACACAGGCGGAAA
AGTGTGCAATAAGAACTTCCAGCTTCTTATACTTGATCATGTTGAGACCCCTAACCTGAAGGCCCAGTGG
AAGCCCTGGACTAATGGGACTTGTCAACTGTTTTTGTCCTGCTTGGTGACCAAGGATGACAATGTGAGCT
ACGCTTTGTACAGAGGGAGCACTCTGATCTCCAATCAAAGGAATAGTACCCACTGGGAGAACCAGATTGA
CGCCAGCAGCCTGCACACATACACCTGCAACGTTAGCAACAGAGCCAGCTGGGCAAACCACACCCTGAAC
TTCACCCATGGCTGTCAAAGTGTCCCTTCGAATTTCAGATTTCTGCCCTTTGGGGTGATCATCGTGATTC
TAGTTACATTATTTCTCGGGGCCATCATTTGTTTCTGTGTGTGGACTAAGAAGAGGAAGCAGTTACAGTT
CAGCCCTAAGGAACCTTTGACAATATATGAATATGTCAAGGACTCACGAGCCAGCAGGGATCAACAAGGA
TGCTCTAGGGCCTCTGGATCTCCCTCGGCTGTCCAGGAAGATGGGAGGGGACAAAGAGAATTGGACAGGC
GTGTTTCTGAGGTGCTGGAGCAGTTGCCACAGCAGACTTTCCCTGGAGATAGAGGCACCATGTACTCTAT
GATACAGTGCAAGCCTTCTGATTCCACATCACAAGAAAAATGTACAGTATATTCAGTAGTCCAGCCTTCC
AGGAAGTCTGGATCCAAGAAGAGGAACCAGAACTCTTCCTTAAGTTGTACCGTGTACGAGGAGGTTGGAA
ACCCATGGCTCAAAGCTCACAACCCTGCCAGGCTGAGCCGCAGAGAGCTGGAGAACTTTGATGTCTACTC
CTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_018729
Insert Size 1194 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_018729.2, NP_061199.2
RefSeq Size 3758 bp
RefSeq ORF 1194 bp
Locus ID 18106
UniProt ID Q07763
Gene Summary Heterophilic receptor of the signaling lymphocytic activation molecule (SLAM) family; its ligand is CD48. SLAM receptors triggered by homo- or heterotypic cell-cell interactions are modulating the activation and differentiation of a wide variety of immune cells and thus are involved in the regulation and interconnection of both innate and adaptive immune response. Activities are controlled by presence or absence of small cytoplasmic adapter proteins, SH2D1A/SAP and/or SH2D1B/EAT-2. Acts as activating natural killer (NK) cell receptor (PubMed:8326140, PubMed:12734329, PubMed:19648922, PubMed:20962259). Activating function implicates association with SH2D1A and FYN. Downstreaming signaling involves predominantly VAV1, and, to a lesser degree, INPP5D/SHIP1 and CBL. Signal attenuation in the absence of SH2D1A is proposed to be dependent on INPP5D and to a lesser extent PTPN6/SHP-1 and PTPN11/SHP-2. Stimulates NK cell cytotoxicity, production of IFN-gamma and granule exocytosis (PubMed:8326140, PubMed:15169881, PubMed:15998796, PubMed:22683124). Optimal expansion and activation of NK cells seems to be dependent on the engagement of CD244 with CD48 expressed on neighboring NK cells (PubMed:15905190). Regulation of NK cell activity by adapters Sh2d1b and Sh2d1b2 is reported conflictingly (PubMed:16127454, PubMed:16425036). Acts as costimulator in NK activation by enhancing signals by other NK receptors such as NCR3 and NCR1. At early stages of NK cell differentiation may function as an inhibitory receptor possibly ensuring the self-tolerance of developing NK cells (By similarity). Involved in the regulation of CD8(+) T-cell proliferation; expression on activated T-cells and binding to CD488 provides costimulatory-like function for neighboring T-cells (PubMed:11739483). Inhibits inflammatory responses in dendritic cells (DCs) (PubMed:25643613).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...