P2rx7 (NM_001038887) Mouse Untagged Clone
CAT#: MC209133
P2rx7 (untagged) - Mouse purinergic receptor P2X, ligand-gated ion channel, 7 (P2rx7), transcript variant 4, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI467586; P2X(7); P2X7R |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209133 representing NM_001038887
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCGGCTTGCTGCAGCTGGAACGATGTCTTGCAGTATGAGACAAACAAAGTCACCCGGATCCAGAGCA CGAATTATGGCACCGTCAAGTGGGTCTTGCACATGATCGTCTTTTCCTACATTAGCTTTGCTTTGGTGAG CGATAAGCTGTACCAGCGGAAAGAGCCTGTTATCAGCTCCGTGCACACCAAGGTCAAAGGCATAGCAGAG GTGACGGAGAATGTCACAGAGGGTGGGGTGACGAAGTTAGGACACAGCATCTTTGACACTGCAGACTACA CCTTCCCTTTGCAGGGGAACTCATTCTTTGTCATGACAAACTATGTCAAGTCAGAAGGCCAAGTGCAGAC GCTGTGTCCTGAGGATCTTTCCAACCTCCAGGAGAGTAACCAGACTTCCAAACCACTGCTCAGGAATCCC AGAGCCAAGAAGGAAGAAGGCTTAAGCCTGGAGCTGGCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001038887 |
| Insert Size | 462 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001038887.1, NP_001033976.1 |
| RefSeq Size | 824 bp |
| RefSeq ORF | 462 bp |
| Locus ID | 18439 |
| Gene Summary | Receptor for ATP that acts as a ligand-gated ion channel. Responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Could function in both fast synaptic transmission and the ATP-mediated lysis of antigen-presenting cells. In the absence of its natural ligand, ATP, functions as a scavenger receptor in the recognition and engulfment of apoptotic cells.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) lacks several exons and includes an alternate 3' terminal exon, compared to variant 1. It encodes isoform d which is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227233 | P2rx7 (tGFP-tagged) - Mouse purinergic receptor P2X ligand-gated ion channel 7 (P2rx7) transcript variant 4, (10ug) |
CNY 2090.00 |
|
| MR227233 | P2rx7 (Myc-DDK-tagged) - Mouse purinergic receptor P2X, ligand-gated ion channel, 7 (P2rx7), transcript variant 4 |
CNY 1200.00 |
|
| MR227233L3 | Lenti ORF clone of P2rx7 (Myc-DDK-tagged) - Mouse purinergic receptor P2X, ligand-gated ion channel, 7 (P2rx7), transcript variant 4 |
CNY 3800.00 |
|
| MR227233L4 | Lenti ORF clone of P2rx7 (mGFP-tagged) - Mouse purinergic receptor P2X, ligand-gated ion channel, 7 (P2rx7), transcript variant 4 |
CNY 3800.00 |
