Prm2 (NM_008933) Mouse Untagged Clone
CAT#: MC209232
Prm2 (untagged) - Mouse protamine 2 (Prm2), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI528784; Prm; Prm-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209232 representing NM_008933
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTTCGCTACCGAATGAGGAGCCCCAGTGAGGGTCCGCACCAGGGGCCTGGACAAGACCATGAACGCG AGGAGCAGGGGCAGGGGCAAGGGCTGAGCCCAGAGCGCGTAGAGGACTATGGGAGGACACACAGGGGCCA CCACCACCACAGACACAGGCGCTGCTCTCGTAAGAGGCTACATAGGATCCACAAGAGGCGTCGGTCATGC AGAAGGCGGAGGAGACACTCCTGCCGCCACAGGAGGCGGCATCGCAGAGGCTGCAGAAGATCCCGAAGGA GGAGGAGATGCAGGTGCAGGAAATGTAGGAGGCACCATCACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008933 |
Insert Size | 324 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_008933.2, NP_032959.1 |
RefSeq Size | 624 bp |
RefSeq ORF | 324 bp |
Locus ID | 19119 |
UniProt ID | P07978 |
Gene Summary | Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis, and are the major DNA-binding proteins in the nucleus of sperm in many vertebrates. They package the sperm DNA into a highly condensed complex in a volume less than 5% of a somatic cell nucleus. Many mammalian species have only one protamine (protamine 1); however, a few species, including human and mouse, have two. This gene encodes protamine 2, which is synthesized as a precursor and then cleaved to give rise to a family of protamine 2 peptides. [provided by RefSeq, Sep 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220061 | Prm2 (tGFP-tagged) - Mouse protamine 2 (Prm2), (10ug) |
CNY 2850.00 |
|
MR220061 | Prm2 (Myc-DDK-tagged) - Mouse protamine 2 (Prm2) |
CNY 1200.00 |
|
MR220061L3 | Lenti ORF clone of Prm2 (Myc-DDK-tagged) - Mouse protamine 2 (Prm2) |
CNY 4750.00 |
|
MR220061L4 | Lenti ORF clone of Prm2 (mGFP-tagged) - Mouse protamine 2 (Prm2) |
CNY 4750.00 |