S100b (NM_009115) Mouse Untagged Clone

CAT#: MC209350

S100b (untagged) - Mouse S100 protein, beta polypeptide, neural (S100b), (10ug)



  "NM_009115" in other vectors (6)

CNY 1800.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI850290; Bpb
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209350 representing NM_009115
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCGAGCTGGAGAAGGCCATGGTTGCCCTCATTGATGTCTTCCACCAGTACTCCGGGCGAGAGGGTG
ACAAGCACAAGCTGAAGAAGTCAGAACTGAAGGAGCTTATCAACAACGAGCTCTCTCACTTCCTGGAGGA
AATCAAGGAGCAGGAAGTGGTGGACAAAGTGATGGAGACGCTGGACGAAGATGGGGATGGGGAGTGTGAC
TTCCAGGAGTTCATGGCCTTCGTCGCCATGGTGACCACGGCCTGCCATGAGTTCTTTGAACATGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_009115
Insert Size 279 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC061178, AAH61178
RefSeq Size 1676 bp
RefSeq ORF 279 bp
Locus ID 20203
UniProt ID P50114
Gene Summary Weakly binds calcium but binds zinc very tightly-distinct binding sites with different affinities exist for both ions on each monomer. Physiological concentrations of potassium ion antagonize the binding of both divalent cations, especially affecting high-affinity calcium-binding sites. Binds to and initiates the activation of STK38 by releasing autoinhibitory intramolecular interactions within the kinase. Interaction with AGER after myocardial infarction may play a role in myocyte apoptosis by activating ERK1/2 and p53/TP53 signaling. Could assist ATAD3A cytoplasmic processing, preventing aggregation and favoring mitochondrial localization. May mediate calcium-dependent regulation on many physiological processes by interacting with other proteins, such as TPR-containing proteins, and modulating their activity (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...