Scd1 (NM_009127) Mouse Untagged Clone

CAT#: MC209357

Scd1 (untagged) - Mouse stearoyl-Coenzyme A desaturase 1 (Scd1), (10ug)



  "NM_009127" in other vectors (4)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA589638; ab; AI265570; Scd; Scd-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209357 representing NM_009127
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGGCCCACATGCTCCAAGAGATCTCCAGTTCTTACACGACCACCACCACCATCACTGCACCTCCCT
CCGGAAATGAACGAGAGAAGGTGAAGACGGTGCCCCTCCACCTGGAAGAAGACATCCGTCCTGAAATGAA
AGAAGATATTCACGACCCCACCTATCAGGATGAGGAGGGACCCCCGCCCAAGCTGGAGTACGTCTGGAGG
AACATCATTCTCATGGTCCTGCTGCACTTGGGAGGCCTGTACGGGATCATACTGGTTCCCTCCTGCAAGC
TCTACACCTGCCTCTTCGGGATTTTCTACTACATGACCAGCGCTCTGGGCATCACAGCCGGGGCTCATCG
CCTCTGGAGCCACAGAACTTACAAGGCACGGCTGCCCCTGCGGATCTTCCTTATCATTGCCAACACCATG
GCGTTCCAGAATGACGTGTACGAATGGGCCCGAGATCACCGCGCCCACCACAAGTTCTCAGAAACACACG
CCGACCCTCACAATTCCCGCCGTGGCTTCTTCTTCTCTCACGTGGGTTGGCTGCTTGTGCGCAAACACCC
GGCTGTCAAAGAGAAGGGCGGAAAACTGGACATGTCTGACCTGAAAGCCGAGAAGCTGGTGATGTTCCAG
AGGAGGTACTACAAGCCCGGCCTCCTGCTGATGTGCTTCATCCTGCCCACGCTGGTGCCCTGGTACTGCT
GGGGCGAGACTTTTGTAAACAGCCTGTTCGTTAGCACCTTCTTGCGATACACTCTGGTGCTCAACGCCAC
CTGGCTGGTGAACAGTGCCGCGCATCTCTATGGATATCGCCCCTACGACAAGAACATTCAATCCCGGGAG
AATATCCTGGTTTCCCTGGGTGCCGTGGGCGAGGGCTTCCACAACTACCACCACACCTTCCCCTTCGACT
ACTCTGCCAGTGAGTACCGCTGGCACATCAACTTCACCACGTTCTTCATCGACTGCATGGCTGCCCTGGG
CCTGGCTTACGACCGGAAGAAAGTTTCTAAGGCTACTGTCTTAGCCAGGATTAAGAGAACTGGAGACGGG
AGTCACAAGAGTAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_009127
Insert Size 1068 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC007474, AAH07474
RefSeq Size 4844 bp
RefSeq ORF 1068 bp
Locus ID 20249
UniProt ID P13516
Gene Summary Stearyl-CoA desaturase that utilizes O(2) and electrons from reduced cytochrome b5 to introduce the first double bond into saturated fatty acyl-CoA substrates. Catalyzes the insertion of a cis double bond at the Delta-9 position into fatty acyl-CoA substrates including palmitoyl-CoA and stearoyl-CoA (PubMed:11500518, PubMed:11533264, PubMed:16275639, PubMed:16443825, PubMed:26098370). Gives rise to a mixture of 16:1 and 18:1 unsaturated fatty acids (PubMed:11500518, PubMed:11533264, PubMed:16443825, PubMed:26098370). Plays an important role in lipid biosynthesis (PubMed:17127673, PubMed:10899171, PubMed:11500518, PubMed:11441127, PubMed:11533264, PubMed:12177411, PubMed:26098370). Plays an important role in regulating the expression of genes that are involved in lipogenesis and in regulating mitochondrial fatty acid oxidation (PubMed:12177411, PubMed:17127673, PubMed:24356954, PubMed:24295027). Plays an important role in body energy homeostasis (PubMed:17127673, PubMed:15210843, PubMed:24295027, PubMed:24356954). Contributes to the biosynthesis of membrane phospholipids, cholesterol esters and triglycerides (PubMed:10899171, PubMed:11500518, PubMed:11441127, PubMed:11533264, PubMed:12177411, PubMed:15210843, PubMed:26098370). Required for normal development of sebaceous glands (PubMed:17738154, PubMed:11533264). Required for the biosynthesis of normal levels of Delta-9 unsaturated fatty acids and 1-alkyl-2,3-diacylglycerol in the Harderian gland (PubMed:11500518). Required for normal production of meibum, an oily material that prevents drying of the cornea (PubMed:11533264).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...