Cxcl12 (NM_013655) Mouse Untagged Clone
CAT#: MC209372
Cxcl12 (untagged) - Mouse chemokine (C-X-C motif) ligand 12 (Cxcl12), transcript variant 2, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | PB; Pbsf; PBSF/SD; Scyb1; Scyb12; Sdf; SDF-; Sdf1; TLS; Tlsf; TP; Tpar1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209372 representing NM_013655
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGCCAAGGTCGTCGCCGTGCTGGCCCTGGTGCTGGCCGCGCTCTGCATCAGTGACGGTAAACCAG TCAGCCTGAGCTACCGATGCCCCTGCCGGTTCTTCGAGAGCCACATCGCCAGAGCCAACGTCAAGCATCT GAAAATCCTCAACACTCCAAACTGTGCCCTTCAGATTGTTGCACGGCTGAAGAACAACAACAGACAAGTG TGCATTGACCCGAAATTAAAGTGGATCCAAGAGTACCTGGAGAAAGCTTTAAACAAGAGGCTCAAGATGT GA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_013655 |
| Insert Size | 282 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_013655.4, NP_038683.1 |
| RefSeq Size | 3173 bp |
| RefSeq ORF | 282 bp |
| Locus ID | 20315 |
| UniProt ID | P40224 |
| Gene Summary | This gene encodes a member of the alpha chemokine protein family. The encoded protein is secreted and functions as the ligand for the G-protein coupled receptor, chemokine (C-X-C motif) receptor 4. The encoded protein plays a role in many diverse cellular functions, including embryogenesis, immune surveillance, inflammation response, tissue homeostasis, and tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region compared to variant 3. The resulting isoform (beta) is shorter and has a distinct C-terminus compared to isoform gamma. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227229 | Cxcl12 (tGFP-tagged) - Mouse chemokine (C-X-C motif) ligand 12 (Cxcl12) transcript variant 2, (10ug) |
CNY 4370.00 |
|
| MR227229 | Cxcl12 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 12 (Cxcl12), transcript variant 2 |
CNY 1800.00 |
|
| MR227229L3 | Lenti ORF clone of Cxcl12 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 12 (Cxcl12), transcript variant 2 |
CNY 5890.00 |
|
| MR227229L4 | Lenti ORF clone of Cxcl12 (mGFP-tagged) - Mouse chemokine (C-X-C motif) ligand 12 (Cxcl12), transcript variant 2 |
CNY 5890.00 |
