Stx1a (NM_016801) Mouse Untagged Clone

CAT#: MC209479

Stx1a (untagged) - Mouse syntaxin 1A (brain) (Stx1a), (10ug)



  "NM_016801" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Goat Polyclonal Antibody against STX1A / STX1B2
    • 100 ug

CNY 5371.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms HPC-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209479 representing NM_016801
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGACCGAACCCAGGAGCTCCGCACGGCCAAGGACAGCGATGACGACGACGATGTCACTGTCACTG
TGGACCGAGACCGCTTCATGGATGAATTCTTTGAACAGGTGGAAGAGATCCGGGGCTTTATTGACAAGAT
TGCCGAAAACGTGGAGGAGGTGAAGCGGAAACACAGCGCCATCCTGGCCTCCCCGAACCCCGATGAGAAG
ACAAAGGAGGAACTGGAGGAGCTCATGTCGGACATTAAGAAGACAGCGAACAAAGTTCGCTCCAAGCTAA
AGAGCATTGAGCAGAGCATCGAGCAGGAGGAAGGTCTGAACCGCTCATCAGCCGACCTGAGGATCCGGAA
GACGCAGCACTCCACGCTGTCCCGAAAGTTTGTGGAGGTCATGTCCGAGTACAACGCCACTCAGTCAGAC
TACCGAGAACGCTGCAAAGGGCGCATCCAGAGGCAGCTGGAGATCACCGGCCGGACCACGACCAGTGAGG
AATTGGAAGACATGCTGGAGAGTGGGAACCCTGCCATCTTTGCCTCTGGGATCATCATGGACTCCAGCAT
CTCGAAGCAGGCCCTCAGTGAGATCGAGACCAGACACAGTGAGATCATCAAGCTGGAGACCAGCATCCGG
GAGCTGCACGACATGTTCATGGACATGGCCATGCTGGTGGAGAGCCAGGGGGAGATGATTGACAGGATCG
AGTACAATGTGGAGCACGCCGTGGACTACGTGGAGAGGGCCGTGTCAGACACCAAGAAGGCCGTCAAGTA
CCAGAGCAAGGCGCGCAGGAAGAAGATCATGATCATCATTTGCTGTGTGATTCTGGGCATCATCATCGCC
TCCACCATCGGGGGCATCTTTGGATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_016801
Insert Size 867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_016801.4, NP_058081.2
RefSeq Size 2206 bp
RefSeq ORF 867 bp
Locus ID 20907
UniProt ID O35526
Gene Summary Plays an essential role in hormone and neurotransmitter calcium-dependent exocytosis and endocytosis (PubMed:17502420, PubMed:28596237, PubMed:28031464). Part of the SNARE (Soluble NSF Attachment Receptor) complex composed of SNAP25, STX1A and VAMP2 which mediates the fusion of synaptic vesicles with the presynaptic plasma membrane. STX1A and SNAP25 are localized on the plasma membrane while VAMP2 resides in synaptic vesicles. The pairing of the three SNAREs from the N-terminal SNARE motifs to the C-terminal anchors leads to the formation of the SNARE complex, which brings membranes into close proximity and results in final fusion. Participates in the calcium-dependent regulation of acrosomal exocytosis in sperm (PubMed:12101244). Plays also an important role in the exocytosis of hormones such as insulin or glucagon-like peptide 1 (GLP-1) (PubMed:17502420, PubMed:28596237, PubMed:28031464).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...