Uba52 (NM_019883) Mouse Untagged Clone
CAT＃: MC209607
Uba52 (untagged) - Mouse ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Cep52; D8Ertd21e; Gm1863; Rps27a; Ubb; Ubc |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209607 representing NM_019883
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGATCTTCGTGAAGACCCTGACGGGCAAGACCATCACTCTTGAGGTCGAGCCCAGTGACACCATCG AGAATGTCAAGGCCAAGATCCAAGACAAGGAAGGCATCCCACCTGACCAGCAGAGGCTGATATTCGCGGG CAAACAGCTGGAGGATGGCCGCACCCTGTCCGACTACAACATCCAGAAAGAGTCCACCTTGCACCTGGTG CTGCGTCTGCGCGGTGGCATCATTGAGCCATCCCTTCGTCAGCTTGCCCAGAAGTACAACTGTGACAAGA TGATCTGCCGCAAGTGCTACGCACGCCTGCACCCTCGTGCAGTCAACTGCCGCAAGAAGAAGTGCGGCCA TACCAACAACCTGCGCCCCAAGAAGAAGGTCAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_019883 |
| Insert Size | 387 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_019883.3, NP_063936.1 |
| RefSeq Size | 524 bp |
| RefSeq ORF | 387 bp |
| Locus ID | 22186 |
| UniProt ID | P62984 |
| Gene Summary | Ubiquitin: Exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked: Lys-6-linked may be involved in DNA repair; Lys-11-linked is involved in ERAD (endoplasmic reticulum-associated degradation) and in cell-cycle regulation; Lys-29-linked is involved in lysosomal degradation; Lys-33-linked is involved in kinase modification; Lys-48-linked is involved in protein degradation via the proteasome; Lys-63-linked is involved in endocytosis, DNA-damage responses as well as in signaling processes leading to activation of the transcription factor NF-kappa-B. Linear polymer chains formed via attachment by the initiator Met lead to cell signaling. Ubiquitin is usually conjugated to Lys residues of target proteins, however, in rare cases, conjugation to Cys or Ser residues has been observed. When polyubiquitin is free (unanchored-polyubiquitin), it also has distinct roles, such as in activation of protein kinases, and in signaling.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG225247 | Uba52 (tGFP-tagged) - Mouse ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52), (10ug) |
CNY 2850.00 |
|
| MR225247 | Uba52 (Myc-DDK-tagged) - Mouse ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) |
CNY 1200.00 |
|
| MR225247L3 | Lenti ORF clone of Uba52 (Myc-DDK-tagged) - Mouse ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) |
CNY 4750.00 |
|
| MR225247L4 | Lenti ORF clone of Uba52 (mGFP-tagged) - Mouse ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) |
CNY 4750.00 |
