Ucn (NM_021290) Mouse Untagged Clone
CAT#: MC209615
Ucn (untagged) - Mouse urocortin (Ucn), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Mpv17; Ucn1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209615 representing NM_021290
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATACAGAGGGGACGCGCTACGCTCCTGGTGGCGTTGCTGCTCTTGGCACAGCTTCGCCCGGAGAGCA GCCAGTGGAGCCCAGCGGCTGCGGCGGCAACTGGGGTCCAGGATCCGAATCTGCGATGGAGCCCTGGAGT GCGGAATCAGGGCGGCGGCGTCCGCGCGCTCCTCTTGCTGTTAGCGGAGCGCTTCCCGCGCCGCGCAGGA TCTGAGCCTGCGGGCGAGCGGCAGCGACGGGACGACCCTCCACTGTCCATCGACCTCACCTTCCACCTGC TGCGGACCCTGCTGGAGCTAGCTCGGACACAGAGCCAGCGCGAGCGCGCAGAGCAGAACCGCATCATATT CGATTCGGTGGGCAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_021290 |
| Insert Size | 369 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021290.2, NP_067265.1 |
| RefSeq Size | 644 bp |
| RefSeq ORF | 369 bp |
| Locus ID | 22226 |
| UniProt ID | P81615 |
| Gene Summary | This gene encodes a member of the corticotropin-releasing hormone peptide family that participates in coordinating autonomic, endocrine, and behavioral responses to stress. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional hormone. Mice lacking the encoded protein exhibit a heightened anxiety-like behaviors and a significantly reduced acoustic startle response. [provided by RefSeq, Sep 2016] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG221871 | Ucn (tGFP-tagged) - Mouse urocortin (Ucn), (10ug) |
CNY 2850.00 |
|
| MR221871 | Ucn (Myc-DDK-tagged) - Mouse urocortin (Ucn) |
CNY 1200.00 |
|
| MR221871L3 | Lenti ORF clone of Ucn (Myc-DDK-tagged) - Mouse urocortin (Ucn) |
CNY 4750.00 |
|
| MR221871L4 | Lenti ORF clone of Ucn (mGFP-tagged) - Mouse urocortin (Ucn) |
CNY 4750.00 |
