Abcc5 (NM_176839) Mouse Untagged Clone
CAT#: MC209798
Abcc5 (untagged) - Mouse ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (Abcc5), transcript variant 2, (10ug)
CNY 3990.00
Product images
                    
                Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | 2900011L11Rik; Abcc; Abcc5a; Abcc5b; AI132311; Mr; Mrp5 | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >MC209798 representing NM_176839 
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAAGATATTGACATGGGAAAAGAATATATCATCCCCAGCCCTGGGTACAGAAGTGACAGGGACAGAA GCGCTGTACCAGGGCAACACAGAGACCCCGAGGAACCCAGGTTCCGGAGAACAAGATCGTTGGAATGCCA AGATGCTCTCGAAACAGCAGCCCGAGTTGAGGGGCTTTCCCTGGATATCTCTGTGCATTCTCATCTCCAA ATTCTGGACGAGGAGCATTCTAAGGGAAAATACCACCATGGTTTAAGTGTCCTGAAGCCCTTCCGGACCA CTACCAAGCACCAGCACCCAGTGGACAATGCTGGACTTTTCTCCTACATGACCTTTTCATGGCTCTCTCC TCTGGCCCGAGTGGTTCACAAGAAGGGGGAGCTGTTAATGGAGGATGTGTGGCCTTTGTCCAAGTATGAG TCTTCTGATGTGAACAGCAGAAGACTAGAGAGACTGTGGCAAGAAGAGCTGAATGAAGTTGGGCCAGACG CTGCCTCCCTGCGAAGGGTTGTGTGGATCTTTTGCCGCACCAGGCTCATCCTGTCCATCGTGTGCCTGAT GATCACGCAGTTGGCTGGCTTCAGTGGACCAAATTTTCAGGATGGCTGTATTCTGCGGTCAGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA  | 
        
| Restriction Sites | SgfI-MluI | 
| ACCN | NM_176839 | 
| Insert Size | 627 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_176839.1, NP_789809.1 | 
| RefSeq Size | 1204 bp | 
| RefSeq ORF | 627 bp | 
| Locus ID | 27416 | 
| Gene Summary | The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks multiple 3' exons but has two alternate 3' exons, as compared to variant 1. The encoded isoform (2) is much shorter and has a distinct C-terminus, as compared to isoform 1.  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG218235 | Abcc5 (tGFP-tagged) - Mouse ATP-binding cassette sub-family C (CFTR/MRP) member 5 (Abcc5) transcript variant 2, (10ug) | 
                                                     CNY 2850.00  | 
                                            |
| MR218235 | Abcc5 (Myc-DDK-tagged) - Mouse ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (Abcc5), transcript variant 2 | 
                                                     CNY 2400.00  | 
                                            |
| MR218235L3 | Lenti ORF clone of Abcc5 (Myc-DDK-tagged) - Mouse ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (Abcc5), transcript variant 2 | 
                                                     CNY 4750.00  | 
                                            |
| MR218235L4 | Lenti ORF clone of Abcc5 (mGFP-tagged) - Mouse ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (Abcc5), transcript variant 2 | 
                                                     CNY 4750.00  | 
                                            
