Timm10 (NM_013899) Mouse Untagged Clone
CAT#: MC209833
Timm10 (untagged) - Mouse translocase of inner mitochondrial membrane 10 homolog (yeast) (Timm10), nuclear gene encoding mitochondrial protein, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Tim13; Timm13a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209833 representing NM_013899
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATCCGCTCAGAGCCCAGCAGCTGGCTGCGGAGCTGGAGGTGGAGATGATGGCTGACATGTACAACA GAATGACCAGTGCCTGCCACCGGAAGTGCGTGCCTCCCCACTACAAGGAGGCAGAGCTGTCCAAAGGCGA GTCTGTGTGTCTGGACCGATGTGTATCCAAGTACTTGGACATCCATGAGAGGATGGGCAAAAAGTTGACA GAGCTGTCAATGCAGGATGAGGAGCTGATGAAGAGGGTACAGCAGAGCTCGGGGCCTGCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_013899 |
Insert Size | 273 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_013899.2, NP_038927.2 |
RefSeq Size | 682 bp |
RefSeq ORF | 273 bp |
Locus ID | 30059 |
UniProt ID | P62073 |
Gene Summary | Mitochondrial intermembrane chaperone that participates in the import and insertion of multi-pass transmembrane proteins into the mitochondrial inner membrane. May also be required for the transfer of beta-barrel precursors from the TOM complex to the sorting and assembly machinery (SAM complex) of the outer membrane. Acts as a chaperone-like protein that protects the hydrophobic precursors from aggregation and guide them through the mitochondrial intermembrane space (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG217356 | Timm10 (tGFP-tagged) - Mouse translocase of inner mitochondrial membrane 10 homolog (yeast) (Timm10) nuclear gene encoding mitochondrial protein, (10ug) |
CNY 2850.00 |
|
MR217356 | Timm10 (Myc-DDK-tagged) - Mouse translocase of inner mitochondrial membrane 10 homolog (yeast) (Timm10), nuclear gene encoding mitochondrial protein |
CNY 1200.00 |
|
MR217356L3 | Lenti ORF clone of Timm10 (Myc-DDK-tagged) - Mouse translocase of inner mitochondrial membrane 10 homolog (yeast) (Timm10), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
MR217356L4 | Lenti ORF clone of Timm10 (mGFP-tagged) - Mouse translocase of inner mitochondrial membrane 10 homolog (yeast) (Timm10), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |