Syt7 (NM_018801) Mouse Untagged Clone
CAT#: MC209985
Syt7 (untagged) - Mouse synaptotagmin VII (Syt7), transcript variant 1, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI851541; B230112P13Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209985 representing NM_018801
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTACCGGGACCCGGAGGCGGCCAGCCCAGGGGCACCTACCCGCGATGTCCTGCTGGTCTCTGCAATCA TCACCGTCAGCCTTAGCGTCACTATCGTCCTCTGCGGCCTGTGCCACTGGTGTCAGCGCAAACTGGGCAA ACGCTACAAGAATTCCTTGGAGACGGTGGGCACGCCAGACTCGGGGCGTGGGCGCGGTGAGAAGAAAGCC ATCAAGTTGCCTGCAGGAGGGAAGGCTGTGAATACAGCCCCAGTGCCCGGCCAGACGCCACACGATGAGT CTGACCGCAGAACGGAGACCCGTTCCTCTGTCTCGGACCTCGTCAACTCCCTTACCAGCGAGATGCTCAT GCTCTCCCCGGGTTCTGAGGAGGATGAGGCCCACGAGGGCTGCAGCCGAGAGAACCTGGGCCGAATCCAG TTCAGTGTTGGCTACAACTTCCAAGAGTCCACACTCACCGTGAAGGTCATGAAGGCCCAAGAGCTGCCAG CCAAGGACTTCAGCGGTACTAGTGACCCCTTTGTCAAGATCTACCTGCTACCCGACAAGAAGCACAAACT GGAGACCAAGGTGAAGCGGAAGAATCTAAACCCGCACTGGAATGAGACCTTTCTATTTGAAGGGTTTCCC TACGAGAAAGTGGTGCAGAGGGTCCTCTACCTCCAGGTCCTGGATTATGACCGTTTCAGCCGCAATGACC CCATTGGGGAGGTGTCCATCCCTCTGAACAAGGTGGACCTGACCCAGATGCAGACCTTCTGGAAGGATCT GAAGCCATGCAGCGATGGGAGTGGGAGCCGAGGGGAGCTGCTCTTGTCCCTCTGCTACAACCCCTCTGCC AACTCCATCATCGTGAACATCATCAAAGCTCGAAACCTCAAAGCCATGGACATCGGGGGCACATCAGACC CCTATGTGAAGGTGTGGCTGATGTATAAAGACAAGCGGGTAGAGAAAAAGAAGACCGTGACAAAGAAGAG GAACCTGAACCCCATCTTCAATGAGTCTTTCGCCTTCGACATACCCACGGAGAAGCTGAGGGAGACCACG ATCATCATCACTGTCATGGACAAAGACAAGCTCAGCCGCAACGACGTCATCGGCAAGATCTACCTGTCCT GGAAGAGCGGACCAGGTGAAGTGAAACACTGGAAGGACATGATCGCTCGTCCCCGGCAGCCTGTGGCCCA GTGGCACCAGCTGAAAGCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_018801 |
Insert Size | 1212 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_018801.3, NP_061271.1 |
RefSeq Size | 6342 bp |
RefSeq ORF | 1212 bp |
Locus ID | 54525 |
UniProt ID | Q9R0N7 |
Gene Summary | Ca(2+) sensor involved in Ca(2+)-dependent exocytosis of secretory and synaptic vesicles through Ca(2+) and phospholipid binding to the C2 domain. Ca(2+) induces binding of the C2-domains to phospholipid membranes and to assembled SNARE-complexes; both actions contribute to triggering exocytosis. SYT7 binds Ca(2+) with high affinity and slow kinetics compared to other synaptotagmins (PubMed:26738595). Involved in Ca(2+)-triggered lysosomal exocytosis, a major component of the plasma membrane repair (By similarity). Ca(2+)-regulated delivery of lysosomal membranes to the cell surface is also involved in the phagocytic uptake of particles by macrophages (PubMed:16982801, PubMed:21041449). Ca(2+)-triggered lysosomal exocytosis also plays a role in bone remodeling by regulating secretory pathways in osteoclasts and osteoblasts (PubMed:18539119). Involved in cholesterol transport from lysosome to peroxisome by promoting membrane contacts between lysosomes and peroxisomes: probably acts by promoting vesicle fusion by binding phosphatidylinositol-4,5-bisphosphate on peroxisomal membranes (PubMed:25860611). Acts as a key mediator of synaptic facilitation, a process also named short-term synaptic potentiation: synaptic facilitation takes place at synapses with a low initial release probability and is caused by influx of Ca(2+) into the axon terminal after spike generation, increasing the release probability of neurotransmitters (PubMed:24569478, PubMed:26738595). Probably mediates synaptic facilitation by directly increasing the probability of release (PubMed:26738595). May also contribute to synaptic facilitation by regulating synaptic vesicle replenishment, a process required to ensure that synaptic vesicles are ready for the arrival of the next action potential: SYT7 is required for synaptic vesicle replenishment by acting as a sensor for Ca(2+) and by forming a complex with calmodulin (PubMed:24569478). Also acts as a regulator of Ca(2+)-dependent insulin and glucagon secretion in beta-cells (PubMed:18308938, PubMed:19171650). Triggers exocytosis by promoting fusion pore opening and fusion pore expansion in chromaffin cells (PubMed:20956309). Also regulates the secretion of some non-synaptic secretory granules of specialized cells (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221926 | Syt7 (tGFP-tagged) - Mouse synaptotagmin VII (Syt7) transcript variant 1, (10ug) |
CNY 3710.00 |
|
MR221926 | Syt7 (Myc-DDK-tagged) - Mouse synaptotagmin VII (Syt7), transcript variant 1 |
CNY 3656.00 |
|
MR221926L3 | Lenti ORF clone of Syt7 (Myc-DDK-tagged) - Mouse synaptotagmin VII (Syt7), transcript variant 1 |
CNY 5230.00 |
|
MR221926L4 | Lenti ORF clone of Syt7 (mGFP-tagged) - Mouse synaptotagmin VII (Syt7), transcript variant 1 |
CNY 5230.00 |