Pdgfc (NM_019971) Mouse Untagged Clone
CAT#: MC209989
Pdgfc (untagged) - Mouse platelet-derived growth factor, C polypeptide (Pdgfc), (10ug)
CNY 5488.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1110064L01Rik; AI647969; PDGF-C |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209989 representing NM_019971
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTCCTCCTCGGCCTCCTCCTGCTGACATCTGCCCTGGCCGGCCAAAGAACGGGGACTCGGGCTGAGT CCAACCTGAGCAGCAAGTTGCAGCTCTCCAGCGACAAGGAGCAGAACGGAGTGCAAGATCCCCGGCATGA GAGAGTTGTCACTATATCTGGTAATGGGAGCATCCACAGCCCGAAGTTTCCTCATACATACCCAAGAAAT ATGGTGCTGGTGTGGAGATTAGTTGCAGTAGATGAAAATGTGCGGATCCAGCTGACATTTGATGAGAGAT TTGGGCTGGAAGATCCAGAAGACGATCTATGCAAGTATGATTTTGTAGAAGTTGAGGAGCCCAGTGATGG AAGTGTTTTAGGACGCTGGTGTGGTTCTGGGACTGTGCCAGGAAAGCAGACGTCTAAAGGAAATCATATC AGGATAAGATTTGTATCTGATGAGTATTTTCCATCTGAACCCGGATTCTGCATCCACTACAGTATTATCA TGCCACAAGTCACAGAAACCACGAGTCCTTCGGTGTTGCCCCCTTCATCTTTGTCATTGGACCTGCTCAA CAACGCTGTGACTGCCTTCAGTACCTTGGAAGAGCTGATTCGGTACCTAGAGCCAGATCGATGGCAGGTG GACTTGGACAGCCTCTACAAGCCAACATGGCAGCTTTTGGGCAAGGCTTTCCTGTATGGGAAAAAAAGCA AAGTGGTGAATCTGAATCTCCTAAAGGAAGAGGTAAAACTCTACAGCTGCACACCCCGGAACTTCTCAGT GTCCATACGGGAAGAGCTAAAGAGGACAGATACCATATTCTGGCCAGGTTGTCTCCTGGTCAAGCGCTGT GGAGGAAATTGTGCCTGTTGTCTCCATAATTGCAATGAATGTCAGTGTGTCCCACGTAAAGTTACAAAAA AGTACCATGAGGTCCTTCAGTTGAGACCAAAAACTGGAGTCAAGGGATTGCATAAGTCACTCACTGATGT GGCTCTGGAACACCACGAGGAATGTGACTGTGTGTGTAGAGGAAACGCAGGAGGGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_019971 |
| Insert Size | 1038 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC037696, AAH37696 |
| RefSeq Size | 3512 bp |
| RefSeq ORF | 1038 bp |
| Locus ID | 54635 |
| UniProt ID | Q8CI19 |
| Gene Summary | Growth factor that plays an essential role in the regulation of embryonic development, cell proliferation, cell migration, survival and chemotaxis. Potent mitogen and chemoattractant for cells of mesenchymal origin. Required for normal skeleton formation during embryonic development, especially for normal development of the craniofacial skeleton and for normal development of the palate. Required for normal skin morphogenesis during embryonic development. Plays an important role in wound healing, where it appears to be involved in three stages: inflammation, proliferation and remodeling. Plays an important role in angiogenesis and blood vessel development. Involved in fibrotic processes, in which transformation of interstitial fibroblasts into myofibroblasts plus collagen deposition occurs. The CUB domain has mitogenic activity in coronary artery smooth muscle cells, suggesting a role beyond the maintenance of the latency of the PDGF domain. In the nucleus, PDGFC seems to have additional function.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG205185 | Pdgfc (tGFP-tagged) - Mouse platelet-derived growth factor, C polypeptide (Pdgfc) |
CNY 7088.00 |
|
| MR205185 | Pdgfc (Myc-DDK-tagged) - Mouse platelet-derived growth factor, C polypeptide (Pdgfc) |
CNY 5488.00 |
|
| MR205185L3 | Lenti ORF clone of Pdgfc (Myc-DDK-tagged) - Mouse platelet-derived growth factor, C polypeptide (Pdgfc) |
CNY 5890.00 |
|
| MR205185L4 | Lenti ORF clone of Pdgfc (mGFP-tagged) - Mouse platelet-derived growth factor, C polypeptide (Pdgfc) |
CNY 5890.00 |

