Nudt11 (NM_021431) Mouse Untagged Clone
CAT#: MC210175
Nudt11 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 11 (Nudt11), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | DIPP3; DIPP3b |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC210175 representing NM_021431
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGTGCAAGCCGAACCAGACGCGGACCTACGACCCCGAGGGCTTCAAGAAGCGCGCCGCGTGCCTGT GCTTCCGCAGCGAGCGCGAGGACGAGGTGCTGCTGGTGAGCAGCAGCCGCTACCCCGACCGCTGGATCGT GCCGGGAGGGGGCATGGAGCCCGAGGAGGAGCCGGACGGCGCGGCGGTGCGCGAGGTGTACGAGGAGGCG GGAGTCAAGGGGAAGTTGGGCCGCTTGCTGGGCGTCTTCGAGCAGAACCAGGACCGCAAGCACCGGACCT ACGTGTTCGTGCTCACCGTCACCGAGCTGCTGGAGGATTGGGAAGACTCGGTCAGCATCGGCAGGAAGCG CGAGTGGTTCAAGATCGAAGATGCCATCAAGGTCCTGCAGTGCCACAAGCCCGTGCACGCCGAGTACCTG GAGAAACTGAAGCTGGGCGGCTCCCCTACTAATGGGAACTCGGCCGCCCCGTCCCCGCCAGAGAGCGAGC CCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_021431 |
| Insert Size | 495 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021431.2, NP_067406.2 |
| RefSeq Size | 2649 bp |
| RefSeq ORF | 495 bp |
| Locus ID | 58242 |
| UniProt ID | P0C027 |
| Gene Summary | Cleaves a beta-phosphate from the diphosphate groups in PP-InsP5 (diphosphoinositol pentakisphosphate), suggesting that it may play a role in signal transduction. Also able to catalyze the hydrolysis of dinucleoside oligophosphates, with Ap6A and Ap5A being the preferred substrates. The major reaction products are ADP and p4a from Ap6A and ADP and ATP from Ap5A. Also able to hydrolyze 5-phosphoribose 1-diphosphate; however, the relevance of such activity in vivo remains unclear.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201319 | Nudt11 (tGFP-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 11 (Nudt11) |
CNY 2850.00 |
|
| MR201319 | Nudt11 (Myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 11 (Nudt11) |
CNY 1200.00 |
|
| MR201319L3 | Lenti ORF clone of Nudt11 (Myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 11 (Nudt11) |
CNY 4750.00 |
|
| MR201319L4 | Lenti ORF clone of Nudt11 (mGFP-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 11 (Nudt11) |
CNY 4750.00 |
