Il21 (NM_021782) Mouse Untagged Clone
CAT#: MC210208
Il21 (untagged) - Mouse interleukin 21 (Il21), (10ug)
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | IL-21 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210208 representing NM_021782
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGAGGACCCTTGTCTGTCTGGTAGTCATCTTCTTGGGGACAGTGGCCCATAAATCAAGCCCCCAAG GGCCAGATCGCCTCCTGATTAGACTTCGTCACCTTATTGACATTGTTGAACAGCTGAAAATCTATGAAAA TGACTTGGATCCTGAACTTCTATCAGCTCCACAAGATGTAAAGGGGCACTGTGAGCATGCAGCTTTTGCC TGTTTTCAGAAGGCCAAACTCAAGCCATCAAACCCTGGAAACAATAAGACATTCATCATCGACCTCGTGG CCCAGCTGAGGAGGAGGCTGCCTGCCAGGAGGGGAGGAAAGAAACAGAAGCACATAGCTAAATGCCCTTC CTGTGATTCGTATGAGAAAAGAACACCCAAAGAATTCCTAGAAAGACTAAAATGGCTCCTTCAAAAGATG ATTCATCAGCATCTCTCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_021782 |
Insert Size | 441 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC125414, AAI25415 |
RefSeq Size | 2421 bp |
RefSeq ORF | 441 bp |
Locus ID | 60505 |
UniProt ID | Q9ES17 |
Gene Summary | Cytokine with immunoregulatory activity. May promote the transition between innate and adaptive immunity. Induces the production of IgG(1) and IgG(3) in B-cells. May play a role in proliferation and maturation of natural killer (NK) cells in synergy with IL15. May regulate proliferation of mature B- and T-cells in response to activating stimuli. In synergy with IL15 and IL18 stimulates interferon gamma production in T-cells and NK cells (By similarity). During T-cell mediated immune response may inhibit dendritic cells (DC) activation and maturation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks a segment in the 3' coding region which results in a frameshift compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226593 | Il21 (tGFP-tagged) - Mouse interleukin 21 (Il21), (10ug) |
CNY 2850.00 |
|
MR226593 | Il21 (Myc-DDK-tagged) - Mouse interleukin 21 (Il21) |
CNY 1200.00 |
|
MR226593L3 | Lenti ORF clone of Il21 (Myc-DDK-tagged) - Mouse interleukin 21 (Il21) |
CNY 4750.00 |
|
MR226593L4 | Lenti ORF clone of Il21 (mGFP-tagged) - Mouse interleukin 21 (Il21) |
CNY 3600.00 |