Fndc4 (NM_022424) Mouse Untagged Clone
CAT#: MC210221
Fndc4 (untagged) - Mouse fibronectin type III domain containing 4 (Fndc4), (10ug)
CNY 2400.00
CNY 3990.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2810430J06Rik; 6330410H20Rik; AB030187; AI838506; AW487863; Fnmp1; FRCP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_022424, the custom clone sequence may differ by one or more nucleotides
ATGCCTCTGGCCCCTCCAGCGAACTCGGTGGAAACCATGGCTTCTTTGATGCCTCTTTCCCCATATCTGA GTCCCACGGTCCTCCTGCTGGTCAGCTGTGACCTGGGTTTTGTGCGAGCAGACCGACCTCCCTCTCCTGT GAATGTGACGGTCACTCATCTCAGAGCCAACTCAGCCACTGTGTCCTGGGACGTTCCAGAAGGCAACATC GTCATTGGCTACTCCATTTCCCAGCAACGACAGAATGGCCCGGGGCAGCGTGTAATCAGAGAAGTGAACA CCACCACCAGGGCCTGCGCTCTCTGGGGCCTGGCTGAAGACAGTGACTACACAGTGCAGGTTAGGAGCAT CGGCCTCCGGGGAGAGAGCCCTCCAGGGCCCCGTGTGCACTTCCGCACGCTCAAGGGTTCTGACAGGCTG CCCTCCAACAGCTCCAGTCCAGGTGATATTACAGTGGAGGGTCTGGATGGAGAGCGGCCATTGCAGACAG GGGAAGTCGTCATCATTGTAGTGGTATTGCTCATGTGGGCTGCTGTAATCGGGCTATTCTGCCGTCAGTA TGACATCATCAAGGACAACGACTCCAACAACAACCCCAAGGAGAAGGGGAAGGGGCCTGAACAGAGTCCT CAGGGAAGGCCAGTGGGGACAACAAGACAGAAAAAGTCTCCATCAATCAACACCATTGATGTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_022424 |
Insert Size | 696 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC139278, AAI39279 |
RefSeq Size | 1567 bp |
RefSeq ORF | 696 bp |
Locus ID | 64339 |
UniProt ID | Q3TR08 |
Gene Summary | Acts as an anti-inflammatory factor in the intestine and colon. Binds to and acts on macrophages to downregulate pro-inflammatory gene expression. Affects key macrophage functions, including phagocytosis, by downregulating many key pathways for macrophage activation, partly via by STAT3 activation and signaling. May be required to dampen the immunological response in colitis.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate splice junction in the 3' end of the coding sequence compared to variant 1, that causes a frameshift. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
FNDC4 acts as an anti-inflammatory factor on macrophages and improves colitis in mice
,null,
Nature Communications
,PubMed ID 27066907
[Fndc4]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223815 | Fndc4 (tGFP-tagged) - Mouse fibronectin type III domain containing 4 (Fndc4), (10ug) |
CNY 2850.00 |
|
MR223815 | Fndc4 (Myc-DDK-tagged) - Mouse fibronectin type III domain containing 4 (Fndc4) |
CNY 2400.00 |
|
MR223815L3 | Lenti ORF clone of Fndc4 (Myc-DDK-tagged) - Mouse fibronectin type III domain containing 4 (Fndc4) |
CNY 4750.00 |
|
MR223815L4 | Lenti ORF clone of Fndc4 (mGFP-tagged) - Mouse fibronectin type III domain containing 4 (Fndc4) |
CNY 4750.00 |