Inip (NM_001013577) Mouse Untagged Clone
CAT#: MC210305
Inip (untagged) - Mouse RIKEN cDNA 1110054O05 gene (1110054O05Rik), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110054O05Rik; 2610312O17Rik; AA399876; Ssbip1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210305 representing NM_001013577
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCAAATCCTTCAGGACAAGGTTTTCAAAATAAAAATAGAGTTGCAATTTTGGCTGAACTGGACA AAGAGAAAAGAAAACTACTTATGCAGAACCAATCTTCAACAAGCCACCCTGGAGCTAGCATCTCGCTCTC CAGACCCTCTCTTACCAAGGACTTCCGGGACCATGCTGAGCAGCAGCACATCGCTGCCCAGCAGAAGGCA GCTTTGCAGCATGCTCACGCACATTCCTCTGGCTACTTCATAACTCAAGACTCTGCCTTTGGGAATCTGA TTCTCCCTGTTTTACCTCGCCTTGACCCCGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001013577 |
Insert Size | 315 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001013577.1, NP_001013595.1 |
RefSeq Size | 3221 bp |
RefSeq ORF | 315 bp |
Locus ID | 66209 |
UniProt ID | Q3TXT3 |
Gene Summary | Component of the SOSS complex, a multiprotein complex that functions downstream of the MRN complex to promote DNA repair and G2/M checkpoint. The SOSS complex associates with single-stranded DNA at DNA lesions and influences diverse endpoints in the cellular DNA damage response including cell-cycle checkpoint activation, recombinational repair and maintenance of genomic stability. Required for efficient homologous recombination-dependent repair of double-strand breaks (DSBs) and ATM-dependent signaling pathways (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG215664 | Inip (tGFP-tagged) - Mouse RIKEN cDNA 1110054O05 gene (1110054O05Rik), (10ug) |
CNY 2850.00 |
|
MR215664 | Inip (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110054O05 gene (1110054O05Rik) |
CNY 1200.00 |
|
MR215664L3 | Lenti ORF clone of Inip (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110054O05 gene (1110054O05Rik) |
CNY 4750.00 |
|
MR215664L4 | Lenti ORF clone of Inip (mGFP-tagged) - Mouse RIKEN cDNA 1110054O05 gene (1110054O05Rik) |
CNY 4750.00 |