Rps23 (NM_024175) Mouse Untagged Clone
CAT#: MC210375
Rps23 (untagged) - Mouse ribosomal protein S23 (Rps23), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2410044J15Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210375 representing NM_024175
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCAAGTGTCGTGGTCTCCGAACTGCCCGGAAGCTCCGCAGTCACCGACGGGACCAGAAGTGGCATG ACAAACAGTACAAGAAAGCCCACTTGGGCACAGCCCTGAAGGCCAATCCGTTTGGGGGTGCCTCTCATGC AAAGGGAATTGTGCTGGAAAAAGTAGGGGTTGAGGCCAAACAGCCAAATTCTGCCATCAGGAAGTGCGTC AGGGTGCAGCTCATTAAGAACGGGAAGAAGATCACAGCGTTCGTGCCCAATGATGGCTGCCTGAACTTCA TTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGAAAAGGTCATGCTGTAGGTGATATTCCTGG AGTCCGCTTTAAGGTGGTTAAAGTAGCCAATGTTTCTCTGTTGGCTCTATACAAAGGCAAGAAAGAAAGG CCAAGATCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_024175 |
Insert Size | 432 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_024175.3, NP_077137.1 |
RefSeq Size | 572 bp |
RefSeq ORF | 432 bp |
Locus ID | 66475 |
UniProt ID | P62267 |
Gene Summary | Component of the ribosome, a large ribonucleoprotein complex responsible for the synthesis of proteins in the cell. The small ribosomal subunit (SSU) binds messenger RNAs (mRNAs) and translates the encoded message by selecting cognate aminoacyl-transfer RNA (tRNA) molecules. The large subunit (LSU) contains the ribosomal catalytic site termed the peptidyl transferase center (PTC), which catalyzes the formation of peptide bonds, thereby polymerizing the amino acids delivered by tRNAs into a polypeptide chain. The nascent polypeptides leave the ribosome through a tunnel in the LSU and interact with protein factors that function in enzymatic processing, targeting, and the membrane insertion of nascent chains at the exit of the ribosomal tunnel. Plays an important role in translational accuracy.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG216204 | Rps23 (tGFP-tagged) - Mouse ribosomal protein S23 (Rps23), (10ug) |
CNY 2850.00 |
|
MR216204 | Rps23 (Myc-DDK-tagged) - Mouse ribosomal protein S23 (Rps23) |
CNY 1200.00 |
|
MR216204L3 | Lenti ORF clone of Rps23 (Myc-DDK-tagged) - Mouse ribosomal protein S23 (Rps23) |
CNY 4750.00 |
|
MR216204L4 | Lenti ORF clone of Rps23 (mGFP-tagged) - Mouse ribosomal protein S23 (Rps23) |
CNY 4750.00 |