Ube2v1 (NM_023230) Mouse Untagged Clone
CAT#: MC210396
Ube2v1 (untagged) - Mouse ubiquitin-conjugating enzyme E2 variant 1 (Ube2v1), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 0610011J09Rik; AI256840; CROC-1; CROC1; D7Bwg1382e; UEV-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210396 representing NM_023230
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCCACCACAGGCTCGGGAGTAAAAGTCCCTCGAAATTTCCGACTGTTGGAAGAGCTGGAAGAAG GACAGAAAGGAGTAGGCGACGGCACAGTTAGCTGGGGTCTGGAGGACGACGAGGACATGACACTTACAAG ATGGACAGGCATGATAATTGGACCTCCACGAACAATCTATGAAAACCGAATATACAGCCTTAAGATAGAG TGTGGGCCTAAGTACCCAGAGGCACCCCCGTCTGTAAGATTCGTAACAAGAGTCAATATGAGCGGCGTGA GCAGTTCGAATGGAGTGGTGGATCCGAGAGCCACGGCAGTGCTGGCAAAGTGGCAGAACTCCCACAGCAT CAAAGTCATCCTGCAGGAACTGCGGCGCCTGATGATGTCAAAAGAGAACATGAAGCTGCCACAGCCGCCG GAAGGACAGTGTTACAGCAATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_023230 |
Insert Size | 444 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_023230.2, NP_075719.1 |
RefSeq Size | 1950 bp |
RefSeq ORF | 444 bp |
Locus ID | 66589 |
UniProt ID | Q9CZY3 |
Gene Summary | Has no ubiquitin ligase activity on its own. The UBE2V1-UBE2N heterodimer catalyzes the synthesis of non-canonical poly-ubiquitin chains that are linked through 'Lys-63'. This type of poly-ubiquitination activates IKK and does not seem to involve protein degradation by the proteasome. Plays a role in the activation of NF-kappa-B mediated by IL1B, TNF, TRAF6 and TRAF2. Mediates transcriptional activation of target genes. Plays a role in the control of progress through the cell cycle and differentiation (By similarity). Plays a role in the error-free DNA repair pathway and contributes to the survival of cells after DNA damage. Promotes TRIM5 capsid-specific restriction activity and the UBE2V1-UBE2N heterodimer acts in concert with TRIM5 to generate 'Lys-63'-linked polyubiquitin chains which activate the MAP3K7/TAK1 complex which in turn results in the induction and expression of NF-kappa-B and MAPK-responsive inflammatory genes (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an internal exon which results in the use of an alternate start codon compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200994 | Ube2v1 (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2 variant 1 (Ube2v1) |
CNY 1200.00 |
|
MR200994L3 | Lenti ORF clone of Ube2v1 (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2 variant 1 (Ube2v1) |
CNY 4750.00 |
|
MR200994L4 | Lenti ORF clone of Ube2v1 (mGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2 variant 1 (Ube2v1) |
CNY 4750.00 |