N6amt1 (NM_026366) Mouse Untagged Clone
CAT＃: MC210622
N6amt1 (untagged) - Mouse N-6 adenine-specific DNA methyltransferase 1 (putative) (N6amt1), transcript variant 1, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 5830445C04Rik; Hemk2; Pred28 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC210622 representing NM_026366
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCGCCGAGTGTCCCCACGCCGTTGTACGGGCACGTGGGTCGCGGAGCCTTCCGCGACGTGTACG AGCCAGCGGAGGACACGTTCCTGTTACTGGACGCGCTCGAGGCGGCGGCGGCCGAGCTAGCAGGAGTGGA AATATGCCTTGAAGTAGGAGCAGGATCTGGTGTGGTGTCTGCATTCCTGGCCTCCATGATAGGTCCTCGG GCCTTATACATGTGCACTGATATCAACCCTGAGGCAGCCGCATGTACCTTGGAAACAGCACGCTGTAACA GAGTCCATGTTCAGCCAGTGATCACAGATTTGGTGCACGGCTTGCTGCCCAGACTGAAGGGGAAAGTAGA CCTGCTGGTGTTTAACCCCCCCTATGTAGTGACTCCGCCTGAAGAGGTAGGAAGTCGTGGAATAGAAGCA GCCTGGGCTGGCGGCAGAAACGGCCGGGAAGTCATGGACAGGTTCTTCCCACTGGCTCCAGAACTCCTCT CCCCAAGAGGGCTGTTCTACTTAGTTACCGTAAAAGAAAACAATCCCGAGGAAATCTTTAAAACAATGAA GACAAGAGGTCTGCAAGGGACCACAGCACTTTGCAGGCAAGCAGGCCAAGAAGCCCTGTCAGTCCTCAGG TTCAGCAAGTCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_026366 |
| Insert Size | 645 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_026366.2, NP_080642.1 |
| RefSeq Size | 1791 bp |
| RefSeq ORF | 645 bp |
| Locus ID | 67768 |
| UniProt ID | Q6SKR2 |
| Gene Summary | Methyltransferase that can methylate both proteins and DNA, and to a lower extent, arsenic (PubMed:20606008, PubMed:26797129). Catalytic subunit of a heterodimer with TRMT112, which catalyzes N5-methylation of Glu residue of proteins with a Gly-Gln-Xaa-Xaa-Xaa-Arg motif (PubMed:26797129). Methylates ETF1 on 'Gln-185'; ETF1 needs to be complexed to ERF3 in its GTP-bound form to be efficiently methylated (PubMed:20606008, PubMed:26797129). Also acts as a N(6)-adenine-specific DNA methyltransferase by mediating methylation of DNA on the 6th position of adenine (N(6)-methyladenosine) (By similarity). N(6)-methyladenosine (m6A) DNA is significantly enriched in exonic regions and is associated with gene transcriptional activation (By similarity). May also play a role in the modulation of arsenic-induced toxicity by mediating the conversion of monomethylarsonous acid (3+) into the less toxic dimethylarsonic acid (By similarity). It however only plays a limited role in arsenic metabolism compared with AS3MT (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227618 | N6amt1 (tGFP-tagged) - Mouse N-6 adenine-specific DNA methyltransferase 1 (putative) (N6amt1) transcript variant 1, (10ug) |
CNY 2850.00 |
|
| MR227618 | N6amt1 (Myc-DDK-tagged) - Mouse N-6 adenine-specific DNA methyltransferase 1 (putative) (N6amt1), transcript variant 1 |
CNY 2400.00 |
|
| MR227618L3 | Lenti ORF clone of N6amt1 (Myc-DDK-tagged) - Mouse N-6 adenine-specific DNA methyltransferase 1 (putative) (N6amt1), transcript variant 1 |
CNY 4750.00 |
|
| MR227618L4 | Lenti ORF clone of N6amt1 (mGFP-tagged) - Mouse N-6 adenine-specific DNA methyltransferase 1 (putative) (N6amt1), transcript variant 1 |
CNY 4750.00 |
