Mob1b (NM_026735) Mouse Untagged Clone
CAT#: MC210729
Mob1b (untagged) - Mouse MOB1, Mps One Binder kinase activator-like 1A (yeast) (Mobkl1a), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110003E08Rik; AU015450; B230364F10; Mobkl1a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210729 representing NM_026735
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCTTCTTGTTTGGTAGTCGCTCTTCTAAAACTTTTAAACCAAAGAAGAACATACCAGAGGGGTCTC ACCAGTATGAACTCTTAAAGCATGCGGAAGCCACACTGGGCAGCGGCAACCTACGGATGGCTGTCATGCT TCCCGAGGGAGAGGATCTGAATGAGTGGGTTGCAGTTAACACTGTGGATTTTTTCAATCAAATCAATATG CTTTATGGAACCATCACAGACTTCTGTACAGAGGAGAGCTGTCCGGTGATGTCAGCTGGACCAAAATATG AATATCACTGGGCAGATGGAACAAACATAAAAAAGCCTATTAAGTGTTCTGCACCAAAGTATATTGATTA CTTGATGACTTGGGTTCAGGACCAGCTGGATGATGAGACATTATTTCCATCAAAAATTGGTGTTCCATTC CCGAAGAATTTCATGTCAGTGGCAAAAACAATACTCAAACGACTCTTTAGAGTTTATGCTCATATTTATC ACCAACATTTTGACCCTGTGATCCAGCTTCAGGAGGAAGCACATCTCAATACATCTTTCAAGCACTTTAT TTTTTTCGTTCAGGAGTTCAACCTTATTGACAGACGAGAGTTGGCACCACTGCAAGAGCTGATTGAAAAA CTCACCTCAAAGGACAGATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_026735 |
Insert Size | 651 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_026735.2, NP_081011.1 |
RefSeq Size | 3171 bp |
RefSeq ORF | 651 bp |
Locus ID | 68473 |
UniProt ID | Q8BPB0 |
Gene Summary | Activator of LATS1/2 in the Hippo signaling pathway which plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Phosphorylation of YAP1 by LATS1/2 inhibits its translocation into the nucleus to regulate cellular genes important for cell proliferation, cell death, and cell migration. Stimulates the kinase activity of STK38L (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218570 | Mob1b (tGFP-tagged) - Mouse MOB1 Mps One Binder kinase activator-like 1A (yeast) (Mobkl1a), (10ug) |
CNY 4370.00 |
|
MR218570 | Mob1b (Myc-DDK-tagged) - Mouse MOB1, Mps One Binder kinase activator-like 1A (yeast) (Mobkl1a) |
CNY 3840.00 |
|
MR218570L3 | Lenti ORF clone of Mob1b (Myc-DDK-tagged) - Mouse MOB1, Mps One Binder kinase activator-like 1A (yeast) (Mobkl1a) |
CNY 5890.00 |
|
MR218570L4 | Lenti ORF clone of Mob1b (mGFP-tagged) - Mouse MOB1, Mps One Binder kinase activator-like 1A (yeast) (Mobkl1a) |
CNY 5890.00 |