Dpf3 (NM_058212) Mouse Untagged Clone
CAT#: MC211044
Dpf3 (untagged) - Mouse D4, zinc and double PHD fingers, family 3 (Dpf3), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2810403B03Rik; 6530402L11Rik; BAF45C; C78788; cer-d4; CERD4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211044 representing NM_058212
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGACTGTCATTCACAACCCCCTGAAAGCGCTTGGGGACCAGTTCTACAAGGAAGCCATTGAGCACT GCCGGAGCTACAACTCGAGGCTGTGCGCAGAGCGGAGCGTGCGTCTCCCCTTCCTGGACTCGCAGACTGG GGTGGCTCAGAACAACTGCTACATCTGGATGGAGAAGAGGCACCGCGGCCCAGGCCTCGCTCCGGGCCAG TTGTACACATACCCTGCCCGCTGCTGGCGCAAGAAGCGACGATTGCACCCACCAGAGGACCCAAAACTAC GACTCCTGGAAATCAAACCCGTAGAACTGCCCCTGAAGAAAGATGGATTTACCTCTGAGAGTACCACACT GGAAGCCTTGCTTCGCGGCGAGGGAGTAGAGAAGAAGGTGGATGCCAGAGAAGAGGAAAGCATCCAGGAG ATACAGAGGGTTTTGGAAAATGATGAAAACGTAGAAGAAGGGAATGAAGAGGAGGATTTGGAAGAAGATG TTCCCAAGCGCAAGAACAGGACCAGAGGACGGGCTCGCGGCTCTGCAGGCGGAAGGAGGAGGCATGATGC CGCCTCTCAGGAAGACCACGACAAACCCTACGTCTGCGACATCTGTGGCAAGCGCTACAAGAACCGGCCA GGACTCAGCTACCACTACGCTCATACTCACCTGGCCAGCGAGGAGGGAGACGAAGCCCAAGACCAGGAGA CCCGATCCCCACCCAACCACAGAAATGAGAACCACAGACCCCAGAAAGGACCAGACGGGACAGTCATTCC TAATAACTACTGTGACTTCTGCTTGGGGGGCTCCAACATGAACAAGAAGAGTGGGAGGCCTGAAGAGCTG GTGTCCTGTGCAGACTGTGGACGCTCTGCTCATTTGGGAGGAGAAGGCAGGAAGGAGAAGGAGGCAGCGG CCGCAGCACGTACCACGGAGGACTTATTCGGTTCCACGTCAGAAAGTGACACCTCAACTTTCTACGGCTT TGATGAGGACGATTTGGAAGAGCCTCGCTCCTGTCGAGGACGCCGCAGTGGCCGGGGTTCACCCACAGCA GATAAAAAGGGCAGCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_058212 |
Insert Size | 1071 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_058212.2, NP_478119.1 |
RefSeq Size | 1529 bp |
RefSeq ORF | 1071 bp |
Locus ID | 70127 |
UniProt ID | P58269 |
Gene Summary | Muscle-specific component of the BAF complex, a multiprotein complex involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Specifically binds acetylated lysines on histone 3 and 4 (H3K14ac, H3K9ac, H4K5ac, H4K8ac, H4K12ac, H4K16ac). In the complex, it acts as a tissue-specific anchor between histone acetylations and methylations and chromatin remodeling. It thereby probably plays an essential role in heart and skeletal muscle development (By similarity). Belongs to the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate in-frame splice site in the central coding region, and uses alternate 3' exon structure and thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224810 | Dpf3 (tGFP-tagged) - Mouse D4 zinc and double PHD fingers family 3 (Dpf3), (10ug) |
CNY 3140.00 |
|
MR224810 | Dpf3 (Myc-DDK-tagged) - Mouse D4, zinc and double PHD fingers, family 3 (Dpf3) |
CNY 3656.00 |
|
MR224810L3 | Lenti ORF clone of Dpf3 (Myc-DDK-tagged) - Mouse D4, zinc and double PHD fingers, family 3 (Dpf3) |
CNY 4750.00 |
|
MR224810L4 | Lenti ORF clone of Dpf3 (mGFP-tagged) - Mouse D4, zinc and double PHD fingers, family 3 (Dpf3) |
CNY 4750.00 |