Syce2 (NM_001168246) Mouse Untagged Clone
CAT#: MC211230
Syce2 (untagged) - Mouse synaptonemal complex central element protein 2 (Syce2), transcript variant 1, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1700013H19Rik; AA407907; Cesc1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211230 representing NM_001168246
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCGCCACGGAAGCTGGCTGCGCTCGCAGGTGGCCGCGCCTCCCGTGGAGTTAAAGGACCAGGAGC CGCCGGCGATTGTGGAGAGCGGAGAGCATCGGCAGAGTGAGAACCACGAGGAGACGCCCGGCTCAGTGGC CCCGAGTGCCAGTTGCCAGCTGCCAGGACCCTTCTCCTCTCTGGACTCTAGCATTGAAACCCTGAAGAAG AAAGCCCAGGAACTGATTGAAAACATCAATGAAAGCAGGCAGAAGGACCATGCACTTATGACCAACTTCA GGGACAGCCTCAAGATGAAGGTCTCAGATCTGACAGAAAAGTTGGAGGAGAGGATGTACCAGGTGTACAG CCACCACAGCAAAATCATTCAGGAAAGACTACAAGAATTTACCCAGAAGATGGCAAAGATCAACCATCTG GAAATGGAGCTTAAACAAGTCTGCCAAACTGTGGAAACGGTGTACAAGGACCTATGTGTCCAGTCTGAGG TTCCCACTTGCGAAGAACAGAATTACAAAGATGGTGAATGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001168246 |
Insert Size | 534 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001168246.1, NP_001161718.1 |
RefSeq Size | 929 bp |
RefSeq ORF | 534 bp |
Locus ID | 71846 |
Gene Summary | Major component of the transverse central element of synaptonemal complexes (SCS), formed between homologous chromosomes during meiotic prophase. Requires SYCP1 in order to be incorporated into the central element. May have a role in the synaptonemal complex assembly, stabilization and recombination.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG214964 | Syce2 (tGFP-tagged) - Mouse synaptonemal complex central element protein 2 (Syce2) transcript variant 1, (10ug) |
CNY 2850.00 |
|
MR214964 | Syce2 (Myc-DDK-tagged) - Mouse synaptonemal complex central element protein 2 (Syce2), transcript variant 1 |
CNY 2400.00 |
|
MR214964L3 | Lenti ORF clone of Syce2 (Myc-DDK-tagged) - Mouse synaptonemal complex central element protein 2 (Syce2), transcript variant 1 |
CNY 4750.00 |
|
MR214964L4 | Lenti ORF clone of Syce2 (mGFP-tagged) - Mouse synaptonemal complex central element protein 2 (Syce2), transcript variant 1 |
CNY 4750.00 |