Syce2 (NM_001168246) Mouse Untagged Clone

CAT#: MC211230

Syce2 (untagged) - Mouse synaptonemal complex central element protein 2 (Syce2), transcript variant 1, (10ug)



  "NM_001168246" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1700013H19Rik; AA407907; Cesc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211230 representing NM_001168246
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCGCCACGGAAGCTGGCTGCGCTCGCAGGTGGCCGCGCCTCCCGTGGAGTTAAAGGACCAGGAGC
CGCCGGCGATTGTGGAGAGCGGAGAGCATCGGCAGAGTGAGAACCACGAGGAGACGCCCGGCTCAGTGGC
CCCGAGTGCCAGTTGCCAGCTGCCAGGACCCTTCTCCTCTCTGGACTCTAGCATTGAAACCCTGAAGAAG
AAAGCCCAGGAACTGATTGAAAACATCAATGAAAGCAGGCAGAAGGACCATGCACTTATGACCAACTTCA
GGGACAGCCTCAAGATGAAGGTCTCAGATCTGACAGAAAAGTTGGAGGAGAGGATGTACCAGGTGTACAG
CCACCACAGCAAAATCATTCAGGAAAGACTACAAGAATTTACCCAGAAGATGGCAAAGATCAACCATCTG
GAAATGGAGCTTAAACAAGTCTGCCAAACTGTGGAAACGGTGTACAAGGACCTATGTGTCCAGTCTGAGG
TTCCCACTTGCGAAGAACAGAATTACAAAGATGGTGAATGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001168246
Insert Size 534 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001168246.1, NP_001161718.1
RefSeq Size 929 bp
RefSeq ORF 534 bp
Locus ID 71846
Gene Summary Major component of the transverse central element of synaptonemal complexes (SCS), formed between homologous chromosomes during meiotic prophase. Requires SYCP1 in order to be incorporated into the central element. May have a role in the synaptonemal complex assembly, stabilization and recombination.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...