Ndufv2 (NM_028388) Mouse Untagged Clone
CAT#: MC211367
Ndufv2 (untagged) - Mouse NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2), nuclear gene encoding mitochondrial protein, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2900010C23Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211367 representing NM_028388
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTCTCCTTGGCGCTGCGGGCCAGGGCGACCGGCCTCGCTGCTCAGTGGGGAAGACATGCAAGGAATT TGCATAAGACAGCAGTGCACAATGGTGCTGGAGGAGCCTTATTTGTGCATAGAGATACTCCTGAGAATAA CCCAGATACTCCATTTGATTTCACACCAGAAAACTATAAGAGGATAGAGGCAATAGTAAAAAACTACCCA GAAGGGCATCAAGCCGCTGCTGTGCTTCCAGTCCTGGATCTCGCCCAAAGGCAGAATGGATGGCTACCTA TCTCCGCTATGAACAAGGTGGCTGAAGTTTTACAAGTACCTCCAATGAGAGTATATGAAGTAGCAACTTT TTATACAATGTATAATCGAAAGCCAGTTGGGAAGTACCATATCCAGGTCTGCACTACTACACCTTGCATG CTGCGAGATTCTGACAGCATATTGGAGACCCTTCAGAGAAAGCTTGGAATAAAGGTTGGAGAGACTACAC CTGACAAACTTTTCACTCTTATAGAAGTGGAATGTTTAGGGGCCTGTGTAAATGCACCGATGGTTCAAAT AAATGACAACTACTATGAGGATCTGACACCCAAGGATATTGAAGAGATTATTGATGAACTCAAAGCTGGA AAAGTTCCCAAACCAGGGCCAAGGAGTGGCCGCTTCTGTTGTGAGCCAGCTGGAGGCCTTACTTCTTTGA CTGAACCACCCAAAGGACCTGGCTTTGGTGTGCAAGCAGGCCTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_028388 |
Insert Size | 747 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_028388.3, NP_082664.1 |
RefSeq Size | 1540 bp |
RefSeq ORF | 747 bp |
Locus ID | 72900 |
UniProt ID | Q9D6J6 |
Gene Summary | This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. This gene is a core subunit and is conserved in prokaryotes and eukaryotes. The bovine ortholog of this protein has been characterized and is reported to contain an iron-sulfur cluster, which may be involved in electron transfer. In humans mutations in this gene are implicated in Parkinson's disease, bipolar disorder, schizophrenia, and have been found in one case of early onset hypertrophic cardiomyopathy and encephalopathy. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203147 | Ndufv2 (tGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2) |
CNY 2850.00 |
|
MR203147 | Ndufv2 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |
|
MR203147L3 | Lenti ORF clone of Ndufv2 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2), nuclear gene encoding mitochondrial protein |
CNY 4800.00 |
|
MR203147L4 | Lenti ORF clone of Ndufv2 (mGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |