Rhoh (NM_001081105) Mouse Untagged Clone
CAT#: MC211563
Rhoh (untagged) - Mouse ras homolog gene family, member H (Rhoh), (10ug)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 5830400A04Rik; Arhh; AU019774 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC211563 representing NM_001081105
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGAGCTCAATCAAGTGCGTGCTGGTAGGGGACAGTGCTGTGGGGAAAACCTCACTGTTGGTGCGCT TCACCTCTGAGACCTTCCCGGAGGCCTACAAACCCACGGTGTACGAGAATACGGGTGTAGACGTCTTCAT GGATGGCATCCAGATCAGCCTGGGTCTCTGGGACACTGCCGGCAACGACGCCTTCAGAAGTATCCGGCCC CTGTCCTACCAGCAGGCAGACGTGGTACTGATGTGCTACTCTGTGGCCAACCATAACTCGTTCCTGAACT TGAAGAACAAATGGATTAGTGAGATCAGGAGCAACCTACCCTGTACCCCGGTGCTGGTTGTGGCCACACA GACGGACCAGAGAGAGGTGGGACCTCACAGGGCTTCCTGCATCAATGCCATAGAAGGGAAGAGACTTGCC CAGGATGTGAGAGCCAAGGGCTACCTGGAGTGCTCAGCCCTCAGCAACCGGGGAGTACAGCAGGTATTTG AATGTGCTGTCCGAACAGCTGTCAACCAGGCCAGGAGGCGAAACAGAAGGAAGCTGTTCTCCATCAATGA ATGCAAGATCTTCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001081105 |
| Insert Size | 576 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC094937, AAH94937 |
| RefSeq Size | 1460 bp |
| RefSeq ORF | 576 bp |
| Locus ID | 74734 |
| UniProt ID | Q9D3G9 |
| Gene Summary | Binds GTP but lacks intrinsic GTPase activity and is resistant to Rho-specific GTPase-activating proteins. Inhibits the activation of NF-kappa-B by TNF and IKKB and the activation of CRK/p38 by TNF. Inhibits activities of RAC1, RHOA and CDC42. Negatively regulates leukotriene production in neutrophils (By similarity). Negative regulator of hematopoietic progenitor cell proliferation, survival and migration. Critical regulator of thymocyte development and T-cell antigen receptor (TCR) signaling by mediating recruitment and activation of ZAP70. Required for phosphorylation of CD3Z, membrane translocation of ZAP70 and subsequent activation of the ZAP70-mediated pathways. Essential for efficient beta-selection and positive selection by promoting the ZAP70-dependent phosphorylation of the LAT signalosome during pre-TCR and TCR signaling. Crucial for thymocyte maturation during DN3 to DN4 transition and during positive selection. Plays critical roles in mast cell function by facilitating phosphorylation of SYK in Fc epsilon RI-mediated signal transduction. Essential for the phosphorylation of LAT, LCP2, PLCG1 and PLCG2 and for Ca(2+) mobilization in mast cells.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG223809 | Rhoh (tGFP-tagged) - Mouse ras homolog gene family member H (Rhoh), (10ug) |
CNY 2850.00 |
|
| MR223809 | Rhoh (Myc-DDK-tagged) - Mouse ras homolog gene family, member H (Rhoh) |
CNY 2400.00 |
|
| MR223809L3 | Lenti ORF clone of Rhoh (Myc-DDK-tagged) - Mouse ras homolog gene family, member H (Rhoh) |
CNY 4750.00 |
|
| MR223809L4 | Lenti ORF clone of Rhoh (mGFP-tagged) - Mouse ras homolog gene family, member H (Rhoh) |
CNY 4750.00 |
