Boll (NM_001113367) Mouse Untagged Clone
CAT#: MC211621
Boll (untagged) - Mouse bol, boule-like (Drosophila) (Boll), transcript variant 2, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 4930554P13Rik; 4930597B14Rik |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC211621 representing NM_001113367
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCAGCGGCTGGAACAATGTATCTGACCACTTCAACTGGGTACCCTTATACTTACCATAATGGCGTTG CTTATTTTCATACTCCAGAAGTAACTTCTGTCCCACCATCTTGGCCTTCACGTTCCATATCTAGTTCTCC TGTGATGGTGGCTCAGCCAGTTTATCAACAGCCTGCATATCACTATCAGGCCCCAGCACAGTGTTTACCA GGGCAGTGGCAGTGGGGTGTTCCCCAGTCCCCTGCTTCTTCTGCTCCATTCCTATATCTGCAACCTTCTG AGGTTATTTATCAGCCAGTAGAAATTGCGCAAGACGGTGGCTGTGTTCCTCCTCCACTGTCTCTGATGGA AACTTCTGTTCCAGAGCCTTATTCTGACCATGGAGTTCAAGCAGCATATCACCAGGTTTATGCTTCAAGT GCCATTGCTATGCCTGCACCTATGATGCAGCCTGAGCCAATTAAAGTAAGGAGTTTATTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001113367 |
| Insert Size | 483 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001113367.1, NP_001106838.1 |
| RefSeq Size | 1087 bp |
| RefSeq ORF | 483 bp |
| Locus ID | 75388 |
| UniProt ID | Q924M5 |
| Gene Summary | Probable RNA-binding protein, which may be required during spermatogenesis. May act by binding to the 3' UTR of mRNAs and regulating their translation (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses a different segment for its 5' end, compared to variant 1. This causes translation initiation at a downstream AUG and a protein (isoform 2) with a shorter N-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG226115 | Boll (tGFP-tagged) - Mouse bol boule-like (Drosophila) (Boll) transcript variant 2, (10ug) |
CNY 2850.00 |
|
| MR226115 | Boll (Myc-DDK-tagged) - Mouse bol, boule-like (Drosophila) (Boll), transcript variant 2 |
CNY 1200.00 |
|
| MR226115L3 | Lenti ORF clone of Boll (Myc-DDK-tagged) - Mouse bol, boule-like (Drosophila) (Boll), transcript variant 2 |
CNY 4750.00 |
|
| MR226115L4 | Lenti ORF clone of Boll (mGFP-tagged) - Mouse bol, boule-like (Drosophila) (Boll), transcript variant 2 |
CNY 4750.00 |
