Syce3 (NM_001162880) Mouse Untagged Clone
CAT＃: MC211633
Syce3 (untagged) - Mouse RIKEN cDNA 1700007E06 gene (1700007E06Rik), transcript variant 1, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1700007E06Rik; TSEG-2; TSEG2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC211633 representing NM_001162880
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGATTCCGATCCTGGGGAAAGAAGCTATGATAACATGCTGAAAATGCTGTCTGACCTGAACAAGG ACCTGGAAAAGCTATTGGAAGAGATGGAAAAAATCTCAGTGCAGGCAACCTGGATGGCCTATGATATGGT GGTCATGCGTACGAACCCCACACTAGCAGAGTCCATGCGCCGGCTAGAAGACGCCTTCCTCAACTGCAAA GAGGAGATGGAGAAGAACTGGCAAGAGCTGCTCACTGAGACCAAGCGCAAGCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001162880 |
| Insert Size | 267 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001162880.1, NP_001156352.1 |
| RefSeq Size | 510 bp |
| RefSeq ORF | 267 bp |
| Locus ID | 75459 |
| UniProt ID | B5KM66 |
| Gene Summary | Major component of the transverse central element of synaptonemal complexes (SCS), formed between homologous chromosomes during meiotic prophase. Required for chromosome loading of the central element-specific SCS proteins, and for initiating synapsis between homologous chromosomes. Chromosome loading appears to require SYCP1. Required for fertility. May play a role in apoptosis of spermatogenic cells and pathogenesis of cryptorchidism.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Both variants encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG215442 | Syce3 (tGFP-tagged) - Mouse RIKEN cDNA 1700007E06 gene (1700007E06Rik) transcript variant 1, (10ug) |
CNY 2850.00 |
|
| MR215442 | Syce3 (Myc-DDK-tagged) - Mouse RIKEN cDNA 1700007E06 gene (1700007E06Rik), transcript variant 1 |
CNY 1200.00 |
|
| MR215442L3 | Lenti ORF clone of Syce3 (Myc-DDK-tagged) - Mouse RIKEN cDNA 1700007E06 gene (1700007E06Rik), transcript variant 1 |
CNY 4750.00 |
|
| MR215442L4 | Lenti ORF clone of Syce3 (mGFP-tagged) - Mouse RIKEN cDNA 1700007E06 gene (1700007E06Rik), transcript variant 1 |
CNY 4750.00 |
