Lyrm7 (NM_029327) Mouse Untagged Clone
CAT#: MC211652
Lyrm7 (untagged) - Mouse LYR motif containing 7 (Lyrm7), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1700024C24Rik; 9330147L21Rik |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC211652 representing NM_029327
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGTCAGCCCGCCAAGGTTTTACAGCTCTTTAAAACACTGCACAGGACCAGACAGCAAGTTTTTAAAA ATGATAAGAGAGCATTGGAAGCAGCCAGAGTAAAGATAAATGAAGAATTCAAAAAACATAAAAACGAGAC ATCTCCAGAGAAAATAAAAGAGATGATGAAACTAGGTTCTGATGTGGAATTATTGCTCAGAACAGCTGTT ATTCAAGGAATTCACACAGACCATGACACACTGCAACTGGTCCCCAGGAAAGATCTTCTCACAGAAAATG TGCCGTACTGTGATGCGCCAACCCAGAAGCAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_029327 |
| Insert Size | 315 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_029327.3, NP_083603.2 |
| RefSeq Size | 2180 bp |
| RefSeq ORF | 315 bp |
| Locus ID | 75530 |
| UniProt ID | Q9DA03 |
| Gene Summary | Assembly factor required for Rieske Fe-S protein UQCRFS1 incorporation into the cytochrome b-c1 (CIII) complex. Functions as a chaperone, binding to this subunit within the mitochondrial matrix and stabilizing it prior to its translocation and insertion into the late CIII dimeric intermediate within the mitochondrial inner membrane (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG216104 | Lyrm7 (tGFP-tagged) - Mouse LYR motif containing 7 (Lyrm7), (10ug) |
CNY 2850.00 |
|
| MR216104 | Lyrm7 (Myc-DDK-tagged) - Mouse LYR motif containing 7 (Lyrm7) |
CNY 1200.00 |
|
| MR216104L3 | Lenti ORF clone of Lyrm7 (Myc-DDK-tagged) - Mouse LYR motif containing 7 (Lyrm7) |
CNY 4750.00 |
|
| MR216104L4 | Lenti ORF clone of Lyrm7 (mGFP-tagged) - Mouse LYR motif containing 7 (Lyrm7) |
CNY 4750.00 |
