Kcnip2 (NM_145703) Mouse Untagged Clone
CAT#: MC211934
Kcnip2 (untagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant a, (10ug)
CNY 2400.00
CNY 3990.00
Cited in 2 publications. |
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | KChI; KChIP2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211934 representing NM_145703
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGGGGCCAAGGCCGAAAGGAGAGTTTGTCCGAATCCCGAGATTTGGACGGCTCCTATGACCAGCTTA CGGGCCACCCTCCAGGGCCCAGTAAAAAAGCCCTGAAGCAGCGTTTCCTCAAGCTGCTGCCGTGCTGCGG GCCCCAAGCCCTGCCCTCAGTCAGTGAAACATTAGCTGCCCCAGCCTCCCTCCGCCCCCACAGACCCCGC CCGCTGGACCCAGACAGCGTGGAGGATGAGTTTGAACTATCCACGGTGTGCCACCGGCCTGAGGGTCTGG AACAACTCCAGGAACAAACCAAGTTCACACGCAGAGAGTTGCAGGTCCTGTACAGAGGCTTCAAGAACGA ATGTCCCAGCGGAATTGTCAACGAGGAGAACTTCAAGCAAATTTATTCTCAGTTCTTTCCCCAAGGAGAC TCCAGCAACTACGCTACTTTTCTCTTCAATGCCTTTGACACCAACCATGATGGCTCTGTCAGTTTTGAGG ACTTTGTGGCTGGTTTGTCAGTGATTCTTCGGGGAACCATAGATGATAGACTGAACTGGGCTTTCAACTT ATATGACCTCAACAAGGATGGCTGTATCACGAAGGAGGAAATGCTCGACATCATGAAGTCCATCTATGAC ATGATGGGCAAGTACACCTACCCTGCCCTCCGGGAGGAGGCCCCGAGGGAACACGTGGAGAGCTTCTTCC AGAAGATGGACAGAAACAAGGACGGCGTGGTGACCATTGAGGAATTCATTGAGTCTTGTCAACAGGACGA GAACATCATGAGGTCCATGCAACTCTTTGATAATGTCATCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_145703 |
Insert Size | 813 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_145703.2, NP_663749.1 |
RefSeq Size | 2414 bp |
RefSeq ORF | 813 bp |
Locus ID | 80906 |
UniProt ID | Q9JJ69 |
Gene Summary | This gene encodes a member of the voltage-gated potassium channel-interacting protein (KCNIP) family. KCNIP family members are small calcium binding proteins that commonly exhibit unique variation at their N-termini, and which modulate A-type potassium channels. This gene is predominantly expressed in the adult heart, and to a lesser extent in the brain. Disruption of this gene is associated with susceptibility to cardiac arrhythmias and lack of transient outward potassium current in ventricular myocytes, and downregulated expression is associated with cardiac hypertrophy. The encoded protein has also been implicated as a repressor of immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013] Transcript Variant: This variant (a) represents the longest transcript and encodes the longest isoform (a, also known as KCHIP2L). |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
A novel bungarotoxin binding site-tagged construct reveals MAPK-dependent Kv4.2 trafficking
,null,
Molecular and cellular neurosciences
,PubMed ID 31212013
[Kcnip2]
|
A polybasic motif in alternatively spliced KChIP2 isoforms prevents Ca2+ regulation of Kv4 channels
,null,
The Journal of Biological Chemistry
,PubMed ID 30622142
[Kcnip2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223165 | Kcnip2 (tGFP-tagged) - Mouse Kv channel-interacting protein 2 (Kcnip2) transcript variant a, (10ug) |
CNY 2850.00 |
|
MR223165 | Kcnip2 (Myc-DDK-tagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant a |
CNY 2400.00 |
|
MR223165L3 | Lenti ORF clone of Kcnip2 (Myc-DDK-tagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant a |
CNY 4750.00 |
|
MR223165L4 | Lenti ORF clone of Kcnip2 (mGFP-tagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant a |
CNY 4750.00 |