Nucks1 (NM_001145804) Mouse Untagged Clone
CAT#: MC212034
Nucks1 (untagged) - Mouse nuclear casein kinase and cyclin-dependent kinase substrate 1 (Nucks1), transcript variant 2, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2700010L10Rik; 8430423A01Rik; AI647518; C78391; Nucks |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212034 representing NM_001145804
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTCGGCCTGTCAGAAATAGGAAGGTTGTGGATTACTCTCAGTTTCAGGAATCAGATGATGCAGATG AAGATTATGGAAGAGATTCAGGCCCTCCTGCTAAGAAGATTCGGTCATCTCCCCGAGAGGCTAAAAATAA GAGGCGATCTGGAAAAAATTCACAAGAAGACAGTGAAGACTCAGAAGAAAAAGATGTGAAGACCAAGAAG GATGATTCTCACTCGGCAGAAGACAGCGAAGATGAAAAAGATGATCATAAAAATGTACGCCAGCAACGAC AGGCAGCATCTAAAGCAGCTTCTAAGCAGAGAGAGATGCTCTTGGAAGATGTTGGCAGCGAGGAAGAGCC GGAAGAAGATGATGAGGCGCCATTCCAGGAGAATTCTGGCAGCGATGAAGATTTCCTAATGGAAGACGAC GATGATAGTGATTATGGCAGTTCAAAAAAGAAAAACAAAAAGATGGTTAAGAAGTCCAAACCTGAGAGAA AAGAAAAGAAAATGCCCAAACCCAGACTAAAGGCAACAGTGACGCCAAGTCCAGTGAAAGGCAAAGCGAA AGTGGGTCGCCCCACAGCTTCGAAGAAATCAAAGGAAAAAACTCCTTCTCCCAAAGAAGAGGATGAGGAA GCAGAAAGCCCTCCAGAAAAGAAGTCCGGAGACGAAGGGTCCGAGGATGAAGCCTCATCTGGGGAAGATT AA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001145804 |
| Insert Size | 702 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001145804.1, NP_001139276.1 |
| RefSeq Size | 6093 bp |
| RefSeq ORF | 702 bp |
| Locus ID | 98415 |
| UniProt ID | Q80XU3 |
| Gene Summary | Chromatin-associated protein involved in DNA repair by promoting homologous recombination (HR). Binds double-stranded DNA (dsDNA) and secondary DNA structures, such as D-loop structures, but with less affinity than RAD51AP1.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site at the 5' end of a coding exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is one aa shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG218534 | Nucks1 (tGFP-tagged) - Mouse nuclear casein kinase and cyclin-dependent kinase substrate 1 (Nucks1) transcript variant 2, (10ug) |
CNY 2850.00 |
|
| MR218534 | Nucks1 (Myc-DDK-tagged) - Mouse nuclear casein kinase and cyclin-dependent kinase substrate 1 (Nucks1), transcript variant 2 |
CNY 2400.00 |
|
| MR218534L3 | Lenti ORF clone of Nucks1 (Myc-DDK-tagged) - Mouse nuclear casein kinase and cyclin-dependent kinase substrate 1 (Nucks1), transcript variant 2 |
CNY 4750.00 |
|
| MR218534L4 | Lenti ORF clone of Nucks1 (mGFP-tagged) - Mouse nuclear casein kinase and cyclin-dependent kinase substrate 1 (Nucks1), transcript variant 2 |
CNY 4750.00 |
