Lin7a (NM_001039354) Mouse Untagged Clone
CAT#: MC212164
Lin7a (untagged) - Mouse lin-7 homolog A (C. elegans) (Lin7a), transcript variant 1, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI848705; LIN-7A; MALS-1; TIP-33; Veli; Veli1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212164 representing NM_001039354
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGAAGCCGAGCGTCACTTCGGCTCCCACGGCAGACATGGCGACATTGACAGTGGTCCAGCCGCTTA CTCTGGACAGAGATGTTGCAAGAGCAATCGAACTACTGGAAAAGCTACAAGAATCTGGAGAAGTACCAGT GCACAAGCTCCAGTCTCTCAAAAAGGTGCTTCAGAGTGAGTTTTGTACAGCAATCCGAGAGGTGTATCAA TACATGCATGAAACGATTACTGTTAATGGCTGCCCTGAATTCCGTGCGAGGGCCACAGCAAAGGCAACAG TTGCAGCTTTTGCAGCCAGCGAAGGCCACTCCCACCCTCGGGTAGTTGAACTGCCAAAGACTGATGAAGG CCTGGGTTTTAATGTGATGGGAGGGAAGGAACAGAATTCCCCGATTTACATCTCCCGCATCATCCCTGGA GGGGTGGCTGAAAGACATGGAGGCCTCAAAAGAGGGGACCAGCTGCTATCAGTGAACGGAGTGAGTGTGG AAGGGGAGCACCATGAGAAAGCTGTGGAACTTCTCAAGGCTGCTAAGGACAGTGTGAAGCTGGTGGTCAG ATACACCCCAAAAGTCCTGGAAGAGATGGAGGCTCGTTTCGAGAAGCTGCGGACAGCTCGGCGTCGACAG CAGCAGCAGTTGCTCATTCAGCAGCAGCAACAGCAGCAGCAACAACAACCACAACAAAACCACATGTCAT AG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001039354 |
| Insert Size | 702 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001039354.1, NP_001034443.1 |
| RefSeq Size | 5887 bp |
| RefSeq ORF | 702 bp |
| Locus ID | 108030 |
| UniProt ID | Q8JZS0 |
| Gene Summary | Plays a role in establishing and maintaining the asymmetric distribution of channels and receptors at the plasma membrane of polarized cells. Forms membrane-associated multiprotein complexes that may regulate delivery and recycling of proteins to the correct membrane domains. The tripartite complex composed of LIN7 (LIN7A, LIN7B or LIN7C), CASK and APBA1 may have the potential to couple synaptic vesicle exocytosis to cell adhesion in brain. Ensures the proper localization of GRIN2B (subunit 2B of the NMDA receptor) to neuronal postsynaptic density and may function in localizing synaptic vesicles at synapses where it is recruited by beta-catenin and cadherin. Required to localize Kir2 channels, GABA transporter (SLC6A12) and EGFR/ERBB1, ERBB2, ERBB3 and ERBB4 to the basolateral membrane of epithelial cells.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG218556 | Lin7a (tGFP-tagged) - Mouse lin-7 homolog A (C. elegans) (Lin7a) transcript variant 1, (10ug) |
CNY 2850.00 |
|
| MR218556 | Lin7a (Myc-DDK-tagged) - Mouse lin-7 homolog A (C. elegans) (Lin7a), transcript variant 1 |
CNY 2400.00 |
|
| MR218556L3 | Lenti ORF clone of Lin7a (Myc-DDK-tagged) - Mouse lin-7 homolog A (C. elegans) (Lin7a), transcript variant 1 |
CNY 4750.00 |
|
| MR218556L4 | Lenti ORF clone of Lin7a (mGFP-tagged) - Mouse lin-7 homolog A (C. elegans) (Lin7a), transcript variant 1 |
CNY 4750.00 |
