Lin7a (NM_001039354) Mouse Untagged Clone

CAT#: MC212164

Lin7a (untagged) - Mouse lin-7 homolog A (C. elegans) (Lin7a), transcript variant 1, (10ug)



  "NM_001039354" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI848705; LIN-7A; MALS-1; TIP-33; Veli; Veli1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212164 representing NM_001039354
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGAAGCCGAGCGTCACTTCGGCTCCCACGGCAGACATGGCGACATTGACAGTGGTCCAGCCGCTTA
CTCTGGACAGAGATGTTGCAAGAGCAATCGAACTACTGGAAAAGCTACAAGAATCTGGAGAAGTACCAGT
GCACAAGCTCCAGTCTCTCAAAAAGGTGCTTCAGAGTGAGTTTTGTACAGCAATCCGAGAGGTGTATCAA
TACATGCATGAAACGATTACTGTTAATGGCTGCCCTGAATTCCGTGCGAGGGCCACAGCAAAGGCAACAG
TTGCAGCTTTTGCAGCCAGCGAAGGCCACTCCCACCCTCGGGTAGTTGAACTGCCAAAGACTGATGAAGG
CCTGGGTTTTAATGTGATGGGAGGGAAGGAACAGAATTCCCCGATTTACATCTCCCGCATCATCCCTGGA
GGGGTGGCTGAAAGACATGGAGGCCTCAAAAGAGGGGACCAGCTGCTATCAGTGAACGGAGTGAGTGTGG
AAGGGGAGCACCATGAGAAAGCTGTGGAACTTCTCAAGGCTGCTAAGGACAGTGTGAAGCTGGTGGTCAG
ATACACCCCAAAAGTCCTGGAAGAGATGGAGGCTCGTTTCGAGAAGCTGCGGACAGCTCGGCGTCGACAG
CAGCAGCAGTTGCTCATTCAGCAGCAGCAACAGCAGCAGCAACAACAACCACAACAAAACCACATGTCAT
AG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001039354
Insert Size 702 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001039354.1, NP_001034443.1
RefSeq Size 5887 bp
RefSeq ORF 702 bp
Locus ID 108030
UniProt ID Q8JZS0
Gene Summary Plays a role in establishing and maintaining the asymmetric distribution of channels and receptors at the plasma membrane of polarized cells. Forms membrane-associated multiprotein complexes that may regulate delivery and recycling of proteins to the correct membrane domains. The tripartite complex composed of LIN7 (LIN7A, LIN7B or LIN7C), CASK and APBA1 may have the potential to couple synaptic vesicle exocytosis to cell adhesion in brain. Ensures the proper localization of GRIN2B (subunit 2B of the NMDA receptor) to neuronal postsynaptic density and may function in localizing synaptic vesicles at synapses where it is recruited by beta-catenin and cadherin. Required to localize Kir2 channels, GABA transporter (SLC6A12) and EGFR/ERBB1, ERBB2, ERBB3 and ERBB4 to the basolateral membrane of epithelial cells.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...