Scgb3a2 (NM_054038) Mouse Untagged Clone
CAT#: MC212302
Scgb3a2 (untagged) - Mouse secretoglobin, family 3A, member 2 (Scgb3a2), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | LuLeu1; Pnsp1; UGRP1; Utgrp1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212302 representing NM_054038
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGCTGGTATCTATCTTTCTGCTGGTGACCATTGGTATTTGTGGTTATTCTGCCACTGCCCTTCTCA TCAACCGTCTCCCTGTTGTTGACAAATTACCTGTACCTTTGGACGACATTATTCCCTCATTTGATCCCTT GAAGATGCTTCTGAAAACCCTGGGCATTTCTGTAGAACATCTGGTGACAGGACTGAAGAAGTGTGTGGAC GAGCTGGGACCAGAGGCTTCCGAGGCCGTGAAGAAGCTTCTGGTAATTATAATTTGTTCTTATTTCCCTG GGAGAAGCCTTTGCTACGTGAACAACCTCCCATCATTTGTAAGTGTATTATTTCTTCCCATGATATGTGC ATATCCCAGGGACTCCAAAAAGCAAACATTTGCATTTATAGAAAGAGTATTTGAACAGTCTAAGCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_054038 |
Insert Size | 420 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_054038.1, NP_473379.1 |
RefSeq Size | 853 bp |
RefSeq ORF | 420 bp |
Locus ID | 117158 |
Gene Summary | Secreted cytokine-like protein (By similarity). Binds to the scavenger receptor MARCO (By similarity). Can also bind to pathogens including the Gram-positive bacterium L.monocytogenes, the Gram-negative bacterium P.aeruginosa, and yeast (By similarity). Strongly inhibits phospholipase A2 (PLA2G1B) activity (PubMed:24213919). Seems to have anti-inflammatory effects in respiratory epithelium (PubMed:16456148, PubMed:25242865). Also has anti-fibrotic activity in lung (PubMed:24213919, PubMed:26559674). May play a role in fetal lung development and maturation (PubMed:18535256). Promotes branching morphogenesis during early stages of lung development (PubMed:18535256). In the pituitary, may inhibit production of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) (PubMed:24514953).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223576 | Scgb3a2 (tGFP-tagged) - Mouse secretoglobin family 3A member 2 (Scgb3a2), (10ug) |
CNY 2850.00 |
|
MR223576 | Scgb3a2 (Myc-DDK-tagged) - Mouse secretoglobin, family 3A, member 2 (Scgb3a2) |
CNY 1200.00 |
|
MR223576L3 | Lenti ORF clone of Scgb3a2 (Myc-DDK-tagged) - Mouse secretoglobin, family 3A, member 2 (Scgb3a2) |
CNY 4750.00 |
|
MR223576L4 | Lenti ORF clone of Scgb3a2 (mGFP-tagged) - Mouse secretoglobin, family 3A, member 2 (Scgb3a2) |
CNY 4750.00 |
其它Scgb3a2产品