Ucn2 (NM_145077) Mouse Untagged Clone
CAT#: MC212434
Ucn2 (untagged) - Mouse urocortin 2 (Ucn2), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Ucn-; Ucn-2; ucn-II; Ucn II |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212434 representing NM_145077
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGACCAGGTGGGCACTGGTGGTGTTCGTGGTCCTGATGTTGGATAGGATCCTATTTGTCCCAGGAA CTCCTATCCCCACCTTCCAGCTCCTCCCTCAGAACTCTCTGGAGACAACTCCTAGCTCTGTGACCTCAGA GAGCTCCTCAGGTACCACCACAGGACCCTCAGCTTCCTGGAGCAACTCTAAAGCCAGCCCTTACCTAGAC ACCCGTGTCATACTCTCCCTGGATGTTCCCATTGGCCTCCTACGGATCTTACTGGAACAGGCTCGTTACA AGGCTGCCAGGAATCAGGCTGCCACTAATGCTCAAATACTAGCCCATGTTGGCCGCCGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_145077 |
Insert Size | 342 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_145077.1, NP_659543.1 |
RefSeq Size | 1002 bp |
RefSeq ORF | 342 bp |
Locus ID | 171530 |
UniProt ID | Q99ML8 |
Gene Summary | This gene encodes a member of the corticotropin-releasing hormone peptide family that participates in coordinating autonomic, endocrine, and behavioral responses to stress. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional hormone. Mice lacking the encoded protein exhibit increased insulin sensitivity and were protected against fat-induced insulin resistance. In addition, female mice lacking the encoded protein exhibit a significant increase in the basal daily rhythms of adrenocorticotropic hormone and corticosterone, and a significant decrease in fluid intake and depressive-like behavior. [provided by RefSeq, Sep 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225350 | Ucn2 (tGFP-tagged) - Mouse urocortin 2 (Ucn2), (10ug) |
CNY 2850.00 |
|
MR225350 | Ucn2 (Myc-DDK-tagged) - Mouse urocortin 2 (Ucn2) |
CNY 1200.00 |
|
MR225350L3 | Lenti ORF clone of Ucn2 (Myc-DDK-tagged) - Mouse urocortin 2 (Ucn2) |
CNY 4750.00 |
|
MR225350L4 | Lenti ORF clone of Ucn2 (mGFP-tagged) - Mouse urocortin 2 (Ucn2) |
CNY 4750.00 |