Nudt15 (NM_172527) Mouse Untagged Clone

CAT#: MC212604

Nudt15 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 15 (Nudt15), (10ug)



  "NM_172527" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Nudt15 Antibody - N-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 6530403O17; A730068G11Rik; MTH2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212604 representing NM_172527
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGCTAACGCAGAGCCGAGGCGGCGGCCAGGAGTTGGGGTCGGCGTGGTGGTGCTGAGCTGCGAGC
ATCCTCGCTGCGTCCTTCTGGGGAAAAGGAAAGGATCGTTTGGAGCCGGCAGTTTCCAGCTTCCTGGGGG
CCATTTGGAATTCGGTGAGACCTGGGAAGAATGCGCTCAGAGAGAAACCTGGGAAGAAGCTGGGCTTCAC
CTGAAAAATGTGTGCTTTGCCTCCGTGGTAAATTCTTTTGTTGAGAAGGAGAATTACCATTATGTTACCA
TATTAATGAAAGGAGAGGTGGATATGACTCATGATTCGGAGCCGAGGAATATGGAGCCTGAAAAGAATGA
AAGTTGGGAGTGGGTTCCATGGGAAGAATTCCCTCCCTTAGACCAGCTTTTCTGGGCTCTCCGCTGTCTA
AAAGAGCAAGGTTATGACCCATTTAAAGAGGACCTGAACCACCTGGAAGGGTACCGAGGAGAGCACCTTG
AAAGGACCACGAAGACTCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_172527
Insert Size 513 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_172527.2, NP_766115.1
RefSeq Size 2592 bp
RefSeq ORF 513 bp
Locus ID 214254
UniProt ID Q8BG93
Gene Summary May catalyze the hydrolysis of nucleoside triphosphates including dGTP, dTTP, dCTP, their oxidized forms like 8-oxo-dGTP and the prodrug thiopurine derivatives 6-thio-dGTP and 6-thio-GTP (PubMed:12767940). Could also catalyze the hydrolysis of some nucleoside diphosphate derivatives (By similarity). Hydrolyzes oxidized nucleosides triphosphates like 8-oxo-dGTP in vitro, but the specificity and efficiency towards these substrates are low. Therefore, the potential in vivo sanitizing role of this enzyme, that would consist in removing oxidatively damaged forms of nucleosides to prevent their incorporation into DNA, is unclear (PubMed:12767940). Through the hydrolysis of thioguanosine triphosphates may participate in the catabolism of thiopurine drugs (By similarity). May also have a role in DNA synthesis and cell cycle progression by stabilizing PCNA (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in its 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...